Choose the correct statement about lysosome and peroxisome functions:
1)Lysosomes and peroxisomes both break down wastes and/or unwanted substances, including long-chain fatty acids.
2)Lysosomes and peroxisomes both break down wastes and/or unwanted substances, but lysosomes also start long-chain fatty acid hydrolysis for respiration.
3)Lysosomes and peroxisomes both break down wastes and unwanted substances, but peroxisomes also store glycogen.
4)Lysosomes and peroxisomes both break down wastes and/or unwanted substances, but peroxisomes also start long-chain fatty acid hydrolysis for respiration.
5)Lysosomes break down wastes and/or unwanted substances, and peroxisomes synthesize long-chain fatty acids.

Answers

Answer 1

The correct statement about lysosome and peroxisome functions is: 1) Lysosomes and peroxisomes both break down wastes and/or unwanted substances, including long-chain fatty acids.

Lysosomes are membrane-bound organelles that contain hydrolytic enzymes that are used to break down a variety of substances, including long-chain fatty acids. Peroxisomes are also membrane-bound organelles that contain enzymes that are used to break down a variety of substances, including long-chain fatty acids.

However, peroxisomes also contain enzymes that are involved in the synthesis of certain lipids and the detoxification of harmful substances. Therefore, while both lysosomes and peroxisomes are involved in the breakdown of wastes and/or unwanted substances, they also have distinct functions.

Learn more about lysosomes and peroxisomes at: https://brainly.com/question/25212390

#SPJ11


Related Questions

Why
is the most conspicuous phase in primitive land plants the
gametophyte phase, but the opposite is true in larger, more
recently evolved land plants?

Answers

The most conspicuous phase in primitive land plants is the gametophyte phase because they are nonvascular plants and do not have specialized tissues for transporting water and nutrients.

Therefore, they rely on the gametophyte phase, which is the dominant phase, for reproduction and survival. In contrast, larger, more recently evolved land plants are vascular plants and have specialized tissues for transporting water and nutrients. This allows them to grow taller and larger, making the sporophyte phase the dominant and most conspicuous phase.

The sporophyte phase produces spores that can disperse and germinate into new gametophytes, allowing for greater reproductive success and survival in a wider range of environments.

You can learn more about gametophyte phase at

https://brainly.com/question/24233327

#SPJ11

______ is a hereditary condition in which red blood cells break down (hemolysis) when the body is exposed to certain foods, drugs, infections or stress.

Answers

The hereditary condition in which red blood cells break down (hemolysis) when the body is exposed to certain foods, drugs, infections or stress is called G6PD deficiency.

This condition is caused by a lack of the enzyme glucose-6-phosphate dehydrogenase (G6PD), which helps red blood cells function properly. Without enough G6PD, red blood cells can break down prematurely, leading to anemia. G6PD deficiency is more common in people of African, Middle Eastern, and Mediterranean descent. It is usually inherited in an X-linked recessive pattern, meaning it affects mostly males. Treatment for G6PD deficiency typically involves avoiding the triggers that can cause hemolysis, such as certain medications, foods, and infections.

For more such questions on G6PD deficiency

https://brainly.com/question/15699503

#SPJ11

(SATA) Signs and Symptoms of Mitral Valve Stenosis:
A. Swollen ankles and feet
B. Heart palpitations (rapid, fluttering heartbeat)
C. Heavy coughing which may produce blood- stained mucus
D. StrokeE. Shortness of breath with exertion or when lying flat

Answers

The correct answers are A. Swollen ankles and feet, B. Heart palpitations (rapid, fluttering heartbeat), C. Heavy coughing which may produce blood-stained mucus, and E. Shortness of breath with exertion or when lying flat.

Mitral valve stenosis is a condition in which the mitral valve of the heart becomes narrowed or blocked, preventing blood from flowing properly through the heart. This can lead to a variety of symptoms, including:
A. Swollen ankles and feet: As blood backs up in the heart, it can cause fluid to build up in the body, leading to swelling in the ankles and feet.
B. Heart palpitations (rapid, fluttering heartbeat): The heart may have to work harder to pump blood through the narrowed valve, leading to a rapid or irregular heartbeat.
C. Heavy coughing which may produce blood-stained mucus: Blood may back up into the lungs, causing congestion and coughing. In severe cases, this can lead to the production of blood-stained mucus.
E. Shortness of breath with exertion or when lying flat: As the heart struggles to pump blood through the narrowed valve, it can cause shortness of breath, especially with exertion or when lying down.
For more such questions on Mitral valve, click on:

https://brainly.com/question/14704580

#SPJ11

Is it required to test the raw materials for micro organisms
before the patch manufacturing of terminal sterilisation parenteral
product? Why??

Answers

Yes, it is required to test the raw materials for microorganisms before the patch manufacturing of terminal sterilization parenteral products.

This is because the presence of microorganisms in the raw materials can potentially contaminate the final product, leading to serious health risks for the patients who use it.

By testing the raw materials for microorganisms, manufacturers can ensure that their products are safe and free of contamination.

This step is crucial in maintaining the quality and safety of the final product, and is required by regulatory agencies such as the FDA.

To know more about sterilization click on below link:

https://brainly.com/question/29388352#

#SPJ11

1) A) describe the differences between eudicot and monocot plants in their tissue organization and overall structures in thr roots.
B) Describe the difference between eudicot and monocot plants in their tissue organization and overall structures in the stems.

Answers

A) Eudicot plants have a root system with a central taproot and lateral roots while Monocot plants have a fibrous root system with many lateral roots. B) Eudicot plants have a stem with a single, cylindrical vascular bundle with xylem and phloem while monocot plants have a stem with scattered vascular bundles with xylem and phloem.

A) Eudicots have a taproot system that forms one major root from which smaller roots branch out. The taproot consists of the primary root and secondary roots. The primary root consists of an epidermis, cortex, and a single primary vascular cylinder with xylem and phloem.  The vascular tissue of eudicots is arranged in a ring that encircles the pith. The root cap is produced by the apical meristem and is composed of parenchyma cells.

On the other hand, the root system of monocots is fibrous, with many thin lateral roots emerging from the stem. The lateral roots have an epidermis, cortex, and a single vascular bundle with xylem and phloem. The vascular tissue in monocots is scattered throughout the root. A small number of epidermal cells cover the root tip, forming the root cap.

B) In eudicots, the vascular tissue is arranged in a ring around the central pith. A layer of cambium between the phloem and xylem produces new vascular tissue. The stem is characterized by a distinct epidermis layer, a cortex layer that lies beneath the epidermis, and a central core of vascular tissue.

On the other hand, monocot stems have a scattered arrangement of vascular tissue, and they lack cambium. The stem consists of a single layer of epidermis, followed by a layer of sclerenchyma, and then a ground tissue of parenchyma. The vascular bundles are scattered throughout the stem. The stem does not have a cambium layer.

Learn more about Eudicots:

https://brainly.com/question/30437851

#SPJ11

How did respiratory pigments, gas exchange organs and hearts all evolve to support a higher metabolic rate and endothermy in birds and mammals? Use Fick's law to support answers.
Can you please type your reply out and make a subsection for each topic: For example, one section for respiratory pigments, one for gas exchange organs and one for hearts? This will help me understand the clear differences. Thank you! I have a brief idea of how it works, but I do not fully understand how the evolution worked to support higher metabolic rates and endothermy.

Answers

Gas exchange organs and hearts all evolve to support a higher metabolic rate and endothermy in birds and mammals. Respiratory pigments, such as hemoglobin and myoglobin, evolved in birds and mammals to allow for the more efficient transport of oxygen.

Due to Fick's law, states that the rate of diffusion is proportional to the concentration gradient and surface area of the diffusing species. The larger surface area offered by the respiratory pigments allowed for a greater rate of oxygen diffusion, leading to higher metabolic rates and endothermy. Gas exchange organs, such as lungs and gills, evolved in birds and mammals to allow for a greater surface area for oxygen diffusion.

The larger surface area offered by the gas exchange organs allowed for a greater rate of oxygen diffusion, leading to higher metabolic rates and endothermy. Hearts evolved in birds and mammals to provide a more efficient circulatory system for oxygen delivery. The efficient circulation of oxygen provided by the hearts allowed for a greater rate of oxygen diffusion, leading to higher metabolic rates and endothermy.

Learn more about myoglobin at:

https://brainly.com/question/30666600

#SPJ11

Which bacteria is more resistant to antibiotics? Why? Explain in at least 3 well-written sentences.

Answers

The bacteria which is more resistant to antibiotics are the Gram-negative bacteria. These are more resistant than the Gram-negative bacteria and are a severe threat to humans and cause severe mortality and morbidity.

In 2017, the World Health Organisation (WHO) published a report stating a list of pathogens that are antibiotic resistant and the majority of the list included Gram-negative bacterial pathogens. The excessive dispensing and irresponsible usage of antibiotics has resulted in the development of these resistant bacterial pathogens. Strategies to fight and control resistant Gram-negative bacteria are modifying the structure of existing antibiotics, developing antimicrobial auxiliary agents and etc. This bacteria represents a health crisis and signals health threats for humans to face.

To know more about resistance and antibiotics,

https://brainly.com/question/10868637

Describe Parsons' theoretical model to analyze modern society,
and explain its key concepts or components.

Answers

Talcott Parsons' theoretical model is a way to analyze modern society and its components. This model attempts to understand how complex societies interact with each other and how their components influence each other.

The key components of this model are the four functional subsystems which are the adaptation system, the goal-attainment system, the integration system, and the pattern maintenance system. The adaptation system is the most important, as it focuses on how individuals and societies can respond to their environment in order to survive and thrive.

The goal-attainment system involves people taking actions to achieve their goals. The integration system looks at how societies keep different parts functioning together. The pattern maintenance system looks at how norms and values in a society stay in place. Through Parsons' model, we can understand how modern society works and how it functions.

To know more about components refer here:

https://brainly.com/question/28835883#

#SPJ11

The blood of an athlete was testing before, during and after a 400m race. In which parts of the race is he respiring aerobically and anaerobically?

Answers

The area showing the areas presenting regions a, b and c are the aerobic respirations whereas the area having the D and E are called as the anaerobic respirations.

What is aerobic respiration ?

It is the respiration which takes place in the presence of oxygen and the anaerobic is the one which takes place in the absence of it.

Aerobic respiration is the process by which cells use oxygen to break down glucose and other molecules to produce ATP, which is the main source of energy for cells.

Anaerobic respiration, on the other hand, is a form of respiration that occurs in the absence of oxygen. This process is less efficient than aerobic respiration and produces less ATP, but can occur in environments where oxygen is scarce or absent.

Overall, aerobic respiration is the preferred method of producing ATP in most cells because it is more efficient and produces more ATP. However, anaerobic respiration can be important in certain situations where oxygen is limited, such as during intense exercise or in some types of bacteria that live in anaerobic environments.

Learn more about aerobic and anaerobic respiration at :

https://brainly.com/question/12605249

#SPJ9

Used only for sacrament of baptism, on festivals of easter, pentecost and epiphany, large separate building from the church, sometime adjoined atrium

Answers

It seems like you are describing a baptistery, which is a structure used specifically for the sacrament of baptism. Baptistries are often found in larger churches or cathedrals, and are typically separate from the main church building, though they may be connected by an atrium or other structure.

These buildings are often used during the major Christian festivals of Easter, Pentecost, and Epiphany, as these are times when baptisms are commonly performed. However, it is important to note that not all churches have separate baptistries, and many simply perform baptisms within the main church building.A baptism is a ceremony in which a person becomes a member of the Christian Church by being held under water for a short time or having drops of water put onto his/her head. Often he/she is also formally given a name

For more such questions on baptistery

https://brainly.com/question/28296319

#SPJ11

The solvent/s or solution/s which can be used to reconstitute small volume Singledose powders for injectable suspension is/are: Select one or more: A. Bocteriostatic Water for Injection B. Bacteriostatic Saline 0.09% for injection
C. Soduum chioride injection USP (Saine Solution 0,09%)
D. Endotoxins free water for injection E. Water for injection F. Sterle water for injection

Answers

The solvent/s or solution/s which can be used to reconstitute small volume are Bacteriostatic Water for Injection, Endotoxins free water for injection ,Water for injection, and option, Sterile water for injection. (A,D,E,F)

These are the solvents or solutions that can be used to reconstitute small volume Single-dose powders for injectable suspension.

Option B. Bacteriostatic Saline 0.09% for injection and option C. Sodium chloride injection USP (Saline Solution 0.09%) are not suitable for reconstituting small volume Single-dose powders for injectable suspension because they contain saline, which can affect the stability of the drug and may lead to precipitation.  (A,D,E,F)

It is important to choose the appropriate solvent or solution for reconstituting small volume Single-dose powders for injectable suspension to ensure the safety and effectiveness of the drug.

Bacteriostatic Water for Injection, Endotoxins free water for injection, Water for injection, and Sterile water for injection are all suitable options because they do not contain any additives that can affect the stability of the drug.

To know more about Sterile water click on below link:

https://brainly.com/question/14974476#

#SPJ11

Question 3 Class II MHC present antigen to Th (CD4) NK
Tc(CD8)
monocytes Question 4 Class I MHC present antigen to Th (CD4) NK
Tc(CD8)
monocytes

Answers

Class II MHC (major histocompatibility complex) molecules are found on the surface of antigen-presenting cells (APCs) and are responsible for presenting antigen to Th (CD4) cells.

These molecules are crucial for the activation of Th cells, which play a key role in the adaptive immune response.

On the other hand, Class I MHC molecules are found on the surface of all nucleated cells and are responsible for presenting antigen to Tc (CD8) cells. These molecules are crucial for the activation of Tc cells, which are responsible for killing infected or cancerous cells.

NK (natural killer) cells and monocytes are not involved in the recognition of antigen presented by MHC molecules. NK cells are part of the innate immune response and are responsible for killing infected or cancerous cells without the need for antigen recognition.

Monocytes are also part of the innate immune response and are responsible for phagocytosis and the production of cytokines.

In summary, Class II MHC molecules present antigen to Th (CD4) cells, while Class I MHC molecules present antigen to Tc (CD8) cells. NK cells and monocytes are not involved in the recognition of antigen presented by MHC molecules.

To know more about antigen-presenting cells click on below link:

https://brainly.com/question/13588471#

#SPJ11

Suppose you are able to observe under the microscope the total number of meiosis occurring in one gonad of a given individual and to outnumber exactly the crossovers between two given loci for which that individual is dihybridic. If the frequency of these particular crossovers is 100% (that is to say that every meiosis exhibits one crossing over between the two loci you consider) you anticipate that the total percentage of recombinant gametes would be equal to:
A. 100 % B. 50 % C. 25 % D. 12.5 %

Answers

The frequency of the particular crossovers is 100%, meaning that every meiosis exhibits one crossing over between the two loci, this results in two recombinant gametes from each meiosis event. The total percentage of recombinant gametes would be equal to is: 50%

The reason is that the individual is dihybridic, meaning it has two pairs of contrasting traits for a given loci. In this situation, every meiosis event will result in one crossover between the two loci. Since each crossover event will result in two recombinant gametes, the total percentage of recombinant gametes produced is 50%.

In meiosis, crossover events between homologous chromosomes occur randomly. During the Prophase I of meiosis, homologous chromosomes form pairs, align and exchange genetic material. This process is called “crossing-over”. It is a mechanism of genetic recombination where a section of one chromosome is exchanged with a similar segment of the other chromosome.

This leads to the formation of recombinant chromosomes, which results in the production of recombinant gametes.

In the example provided, since the frequency of the particular crossovers is 100%, meaning that every meiosis exhibits one crossing over between the two loci, this results in two recombinant gametes from each meiosis event. Thus, the total percentage of recombinant gametes produced is 50%.

To know more about gametes refer here:

https://brainly.com/question/29600905#

#SPJ11

During cold weather operations,___should be conducted to remove the products of combustion from the firefighters prior to removing respiratory protection, and doffing SCBA face pieces.

Answers

During cold weather operations, decontamination should be conducted to remove the products of combustion from the firefighters prior to removing respiratory protection, and doffing SCBA face pieces.

Decontamination is the process of removing or neutralizing contaminants that have accumulated on personnel and equipment. This is important during cold weather operations because the products of combustion can stick to the firefighters and their equipment, causing them harm even after they have left the scene of the fire.

By conducting decontamination before removing respiratory protection and doffing SCBA face pieces, firefighters can ensure that they are not exposed to harmful contaminants. This should be done in a designated decontamination area, using appropriate methods and equipment.

To know more about decontamination here:

https://brainly.com/question/14318265#

#SPJ11

The shortcut to designer babies is gene?

Answers

like the doll? If so its Mattel.

In a AaBBCcDdEe x AabbCcDeEE cross, what is the probability that
the first child will have 8 or more contributing alleles?

Answers

In a AaBBCcDdEe x AabbCcDeEE cross, the probability that the first child will have 8 or more contributing alleles is 3/16.

What is the AaBBCcDdEe x AabbCcDeEE cross?

The AaBBCcDdEe x AabbCcDeEE cross is a dihybrid cross. It is also known as the F1 generation. The offspring of a dihybrid cross is produced by crossing two true-breeding parents that differ in two traits.

The genotype of the parents (AaBBCcDdEe x AabbCcDeEE) contributes one allele for each trait. Therefore, each child has two alleles for each trait. There are five traits in the cross. The following genotypes have eight or more alleles: AABBCcDdEE, AABBCcDdeEe, AaBBCcDdEE, AaBBCcDdeEe, AaBBCcDDee, AaBBccDdEE, AaBBccDdeEe, aaBBCcDdEe, aaBBCcDeeEe. Thus, the probability that the first child will have eight or more contributing alleles is 3/16.

For more information about dihybrid cross refers to the link: https://brainly.com/question/1185199

#SPJ11

How do land plants acquire water?
Select one:
a. Leaves open their stoma, and then water diffuses with carbon dioxide, diffusing through the apoplast or symplast to the xylem.
b. Root hairs use energy to take up minerals and water, and then water diffuses through the apoplast or symplast to the phloem.
c. Root hairs use energy to take up minerals, and then water diffuses in by osmosis, and diffuses through the apoplast or symplast to the phloem.
d. Root hairs use energy to take up minerals, and then water diffuses in by osmosis, and diffuses through the apoplast or symplast to the xylem.

Answers

Land plants acquire water through the root hair. The correct answer is d. Root hairs use energy to take up minerals, and then water diffuses in by osmosis, and diffuses through the apoplast or symplast to the xylem.

Land plants acquire water through their roots, which are specialized for water and nutrient uptake. The root hairs, which are extensions of the root cells, increase the surface area of the roots, allowing for more efficient water and nutrient uptake.

The root hairs use energy to take up minerals from the soil, and water then diffuses into the root cells by osmosis. Once inside the root cells, water can diffuse through the apoplast (the spaces between the cell walls) or the symplast (the spaces within the cells) to the xylem, which is the tissue responsible for transporting water and nutrients throughout the plant.

Learn more about apoplast here: https://brainly.com/question/5971199.

#SPJ11

Overton’s Plasmolytic Method & Membrane Permeability Assignment
Part 1 Data and Questions
Drawing of Elodea cell in 0.8M sucrose solution (after 5 minutes): (6 marks)
Describe what occurred in the above Elodea cell you observed over time. Relate your results to sucrose permeability. (2 marks)
Calculations of average osmotic pressure. Attach a copy of the figure to this assignment. (7 marks)
Explain what factors determine the variability of the plasmolytic state of the Elodea
tissue/cells. (2 marks)

Answers

The Overton's Plasmolytic Method is a technique used to study the permeability of cell membranes.

In this method, a plant cell, such as an Elodea cell, is placed in a sucrose solution of a known concentration and observed over time. The changes in the cell are used to determine the permeability of the cell membrane to sucrose.

In the case of the Elodea cell placed in a 0.8M sucrose solution, it can be observed that the cell undergoes plasmolysis. This is a process in which the cell membrane pulls away from the cell wall as a result of water loss due to osmosis.

The sucrose solution is hypertonic to the cell, meaning that it has a higher concentration of solutes than the cell. As a result, water moves out of the cell and into the solution, causing the cell to shrink and the cell membrane to pull away from the cell wall.

The permeability of the cell membrane to sucrose can be determined by calculating the average osmotic pressure of the solution. This can be done by measuring the change in volume of the cell over time and using the equation for osmotic pressure:

Π = iCRT

Where Π is the osmotic pressure, i is the van't Hoff factor, C is the molar concentration of the solute, R is the gas constant, and T is the temperature in Kelvin.

The variability of the plasmolytic state of the Elodea tissue/cells can be determined by several factors, including the concentration of the sucrose solution, the temperature of the solution, and the presence of other solutes in the solution.

These factors can affect the rate of osmosis and the permeability of the cell membrane, leading to differences in the plasmolytic state of the cells.

To know more about osmotic pressure click on below link:

https://brainly.com/question/29819107#

#SPJ11

What is the relationship between the average annual income of a country’s citizens and the its consumption of energy?
Responses
A Direct, energy consumption increases as average income increasesDirect, energy consumption increases as average income increases
B Inverse, energy consumption decreases as average income increasesInverse, energy consumption decreases as average income increases
C No consistent relationship

Answers

A. Clear relationship between rising average income and rising energy usage Direct energy use rises in direct proportion to average income.

What does it mean to consume energy?

The total amount of energy consumed through end users, including such households, businesses, and agriculture, is known as final energy consumption.Energy is defined as that which is utilized by the final consumer, excluding energy used by the power sector itself.

What leads to energy use?

Economic growth, increased population, and technical advancements are the causes of rising energy demand.

To Know more about energy visit:

https://brainly.com/question/1932868

#SPJ1

A mutation that causes a change in a single nucleotide
in DNA: (Multiple Choice)
a) will have no effect on the resulting protein.
b) causes protein synthesis to stop.
c)changes the corresponding nucle

Answers

A mutation that causes a change in a single nucleotide in DNA.

As per the given statement the correct answer is option c) changes the corresponding nucle.

changes the matching nucleotide in the mRNA, which can lead to the incorporation of a different amino acid into the protein, thereby altering the structure and function of the protein. Point mutations or single nucleotide polymorphisms are terms used to describe this kind of mutation (SNP). The location, type, and significance of the change, as well as the function of the altered amino acid in the protein, all determine how the mutation affects the protein. While some mutations can be quiet, meaning they don't change the protein's amino acid sequence, others can have serious consequences and lead to disease.

For more such questions on mutation, click on:

https://brainly.com/question/14438201

#SPJ11

PLS HELP XOXO NEED ITT RNNN

Answers

The high energy of the X rays allows them to pass through the human body.

Why does x rays pass through the human body?

X-rays pass through the human body because they have a very high energy and short wavelength. This means that they are able to penetrate through materials that are opaque to visible light, such as the human body.

X-rays are a type of electromagnetic radiation, similar to visible light but with much higher energy. When X-rays encounter a material, they can interact with the atoms in the material in different ways.

Learn more about x rays:https://brainly.com/question/23281551

#SPJ1

PLEASE HURRY!
Which is a disadvantage of using wind as an energy source?

It may be unreliable.
It is not naturally occurring.
It produces a lot of waste.
It generates large amounts of electricity.

Answers

Answer:

it may be unreliable.

Explanation:

wind can blow at different speeds, so we don't always know how much electricity we'll be able to generate. this makes it potentially unreliable as a sole source of energy.

Answer: It may be unreliable

Explanation: I learned this in school :D

Portions of the human genome spanning mega bases but with genes
are called Splicesome
Euchromatin
Transcriptional quiescent regions
gene desert

Answers

Portions of the human genome spanning mega bases but with genes are called Euchromatin.

Euchromatin is a term used to describe the regions of the genome that are less condensed and contain actively transcribed genes. These regions tend to be rich in gene content and span large segments of the genome, often spanning megabases.

The other options are :

Transcriptional quiescent regions: Regions of the genome with few genes that are not actively transcribed.

Gene desert: Large regions of the genome with very few genes, often containing repetitive DNA sequences.

Splicesome: A complex of proteins and RNA molecules involved in RNA splicing, not a specific region of the genome.

To know more about Euchromatin click here:

https://brainly.com/question/11858537

#SPJ11

What enzyme synthesizes 28S rRNA in eukaryotes?
option1: RNA Polymerase I
option 2: RNA Polymerase II
option 3: RNA polymerase III
option 4: Reverse Transcriptase
option 5: Ribosome

Answers

The enzyme that synthesizes 28S rRNA in eukaryotes is RNA Polymerase I. The correct answer is option 1.

RNA Polymerase I is responsible for synthesizing large ribosomal RNA (rRNA) molecules in eukaryotic cells, including the 28S rRNA. The 28S rRNA is a component of the large subunit of the ribosome, which is responsible for catalyzing peptide bond formation during protein synthesis.

RNA Polymerase II is responsible for transcribing protein-coding genes to produce messenger RNA (mRNA), while RNA Polymerase III transcribes genes for small RNA molecules such as transfer RNA (tRNA) and small nuclear RNA (snRNA). Reverse transcriptase is an enzyme found in retroviruses that synthesizes DNA from RNA templates, and ribosomes are the cellular structures that translate mRNA into protein.

Learn more about RNA Polymerase I here: https://brainly.com/question/15872478.

#SPJ11

Pick the CORRECT answer and describe WHY it is the correct response. Next, provide a reason why EACH of the other answer options is INCORRECT. Include specific examples to demonstrate your explanations where possible.
1. The pathophysiology underlying micro- and macro-angiopathies seen in diabetes is
Increased susceptibility to infections
Hypoglycemia
Ketoacidosis
Accelerated atherosclerosis
2. The release of adrenocorticotropic hormone (ACTH), thyroid-stimulating hormone (TSH), and follicle-stimulating hormone (FSH) is regulated by
Posterior pituitary gland
Adrenal cortex
Hypothalamic-anterior pituitary axis
Parathyroid glands
3. Signs and symptoms of autoimmune destruction or ischemic damage to the anterior pituitary gland would include
Hypothyroidism
Cushing’s syndrome
Gigantism
Galactorrhea

Answers

1: The pathophysiology underlying micro- and macro-angiopathies seen in diabetes is A: increased susceptibility to infections.

2: The release of adrenocorticotropic hormone (ACTH), thyroid-stimulating hormone (TSH), and follicle-stimulating hormone (FSH) is regulated by C:  Hypothalamic-anterior pituitary axis.

3: Signs and symptoms of autoimmune destruction or ischemic damage to the anterior pituitary gland would include B:  Cushing’s syndrome.

1. The correct answer is Accelerated atherosclerosis because it is the mechanism behind both macro- and micro-angiopathies in diabetes. Increased susceptibility to infections is incorrect because it is not a mechanism behind angiopathies. Hypoglycemia is incorrect because it is a symptom of diabetes, not a mechanism behind angiopathies. Ketoacidosis is incorrect because it is a metabolic state caused by diabetes, not a mechanism behind angiopathies.


2. The correct answer is Hypothalamic-anterior pituitary axis because the hypothalamic-anterior pituitary axis is the mechanism behind the release of the hormones ACTH, TSH, and FSH. Posterior pituitary gland is incorrect because it is where the hormones are released, not where they are regulated. The adrenal cortex is incorrect because it is not involved in the regulation of hormones. Parathyroid glands is incorrect because they are responsible for the regulation of calcium levels, not the hormones.


3. The correct answer is Cushing’s syndrome because it is a sign of autoimmune destruction or ischemic damage to the anterior pituitary gland. Hypothyroidism is incorrect because it is a sign of damage to the thyroid, not the anterior pituitary gland. Gigantism is incorrect because it is a sign of excessive growth hormone production, not damage to the anterior pituitary gland. Galactorrhea is incorrect because it is a sign of excessive prolactin production, not damage to the anterior pituitary gland.

Learn more about Hypothalamic-anterior pituitary axis at

https://brainly.com/question/14620142

#SPJ11

Hereditary nephritis is an X-linked dominant disorder. If the mother has the disease & is heterozygous, what is the odds that the children will have the disease?

Answers

If the mother has the disorder, her sons have a 100% chance of inheriting it, while her daughters have a 50% chance. Hereditary nephritis is an X-linked dominant disorder.

This means that the disorder is caused by a dominant allele located on the X chromosome. If the mother is heterozygous (i.e. she has one dominant allele and one recessive allele), the odds that her children will have the disease are as follows: 

For daughters, the probability of inheriting the disorder is 50% (1/2)For sons, the probability of inheriting the disorder is 100% (1)

Here you can learn more about X-linked dominant disorder

https://brainly.com/question/30245187#

#SPJ11

Axonal growth cones from amphibian retinal ganglion cells are directed to their tectal targets by...
Ephrin receptor gradients in the tectum
Ephrin receptor gradients in the cornea
Ephrin ligand gradients in the retina
Ephrin ligand gradients in the tectum
Slit gradients in the retina

Answers

Axonal growth cones from amphibian retinal ganglion cells are directed to their tectal targets by Ephrin receptor gradients in the tectum

What are the cellular constituents of axonal growth cone?

Axonal growth cones are incredibly dynamic structures found at the tip of axons that are still developing. They are made up of various unique cellular components, such as: Filopodia: The growth cone's thin, actin-based protrusions that extend and retract so it can explore its surroundings and interact with target cells. Lamellipodia: The growth cone's broad, sheet-like extensions, which are also made of actin filaments. Lamellipodia aid in substrate adhesion and direct the growth cone in the direction of the desired outcome. Microtubules: The structurally supportive cylindrical elements that make up the growth cone's framework. Organelles, vesicles, and other cargo are transported through the growth cone on microtubule tracks. Vesicles are membrane-bound organelles that transport the molecules necessary for growth cone function, such as proteins, lipids, and others.

To Know more about Axonal growth  Visit:

brainly.com/question/8888213

#SPJ1

what is the facts about listening to the announcement of your authorities?

Answers

Listening to the announcements of authorities is an important aspect of being an informed and responsible citizen.

What is Authorities?

Authorities are individuals or organizations that hold power or control over a particular area, group, or situation. They are typically recognized as having the right to make decisions, enforce laws and regulations, and exercise control over others in their jurisdiction.

Examples of authorities can include government officials, law enforcement agencies, military organizations, educational institutions, and religious bodies. These authorities may have varying levels of power and influence, and may be responsible for different aspects of society and governance.

Here are some facts about the benefits and importance of listening to such announcements:

Staying informed: Authorities often make announcements to provide information to the public about important issues, events, and policy changes.

Public safety: Authorities may also make announcements related to public safety, such as warnings about severe weather, natural disasters, or other potential hazards.

Compliance: Authorities may issue announcements related to new laws, regulations, or policies.

Civic engagement: Listening to announcements from authorities is an important part of civic engagement and participating in democratic processes.

Learn more about Authorities from given link

https://brainly.com/question/28706376

#SPJ1

Please help me for this question. explain the concept as much as possible. please be clear and don't send other experts explanations. Advantages of using Laser light to generate damage oxidation of bases?

Answers

Laser light has several advantages when it comes to generating damage oxidation of bases. Laser light is highly concentrated and can cause localized heating, which allows for more precise oxidation.

Laser light is a highly focused and concentrated beam of light that is used in a variety of applications. One of the advantages of using laser light to generate damage oxidation of bases is its precision. Laser light can be focused on a very small area, allowing for precise damage to specific bases without affecting surrounding areas. This is especially useful in applications such as DNA sequencing, where it is important to target specific bases without damaging others.

Another advantage of using laser light is its high energy. Laser light can generate enough energy to cause damage oxidation of bases, which is a process that involves the removal of electrons from an atom or molecule. This can be useful in applications such as cancer treatment, where it is important to cause damage to cancer cells without affecting healthy cells.

Overall, the use of laser light to generate damage oxidation of bases has several advantages, including precision and high energy. These advantages make it a valuable tool in a variety of applications, from DNA sequencing to cancer treatment.

To learn more about oxidation, click here:

https://brainly.com/question/25886015

#SPJ11

b. Give an example of how "reusing, reducing, or recycling" could decrease the amount of fossil
fuels used. (0.5 point)

Answers

Answer:

"Reusing, reducing, or recycling" could decrease the amount of fossil fuels used as it lowers global warming/litter

Answer: Reusing, reducing, or recycling can help decrease the number of fossil fuels used in many ways. First, by reusing you limit the number of products needed to fulfill the demand of the human population. As a result, the production of goods is lower, which means the fossil fuels that are used to produce the goods are lowered. The same principle can be applied to reducing. That is to say that reducing what you use allows for the production of fewer goods because you are not buying as much. Recycling allows for what has already been made using fossil fuels to be reused or bought by somebody else. This means that no additional fossil fuels would be used by obtaining a good that was produced using fossil fuels.

Explanation:

Reusing, reducing, or recycling can help decrease the number of fossil fuels used in many ways. First, by reusing you limit the number of products needed to fulfill the demand of the human population. As a result, the production of goods is lower, which means the fossil fuels that are used to produce the goods are lowered. The same principle can be applied to reducing. That is to say that reducing what you use allows for the production of fewer goods because you are not buying as much. Recycling allows for what has already been made using fossil fuels to be reused or bought by somebody else. This means that no additional fossil fuels would be used by obtaining a good that was produced using fossil fuels.

Other Questions
From the candy factory, Stattles candies come in five different colors that are equally distributed (20% orange), and each 14 ounce bag has a random sample of 220 of Stattles. a. Find the mean and standard deviation of the sampling distribution of pb. Calculate the probability that Cindy will get at least 48 orange Stattles in her next 14 ounce bag. Almost all writing fits into one genre or another. This is something that can certainly be debated, and often is. Research the various types of fictional genres, and try to figure out what genre Journey to the Center of the Earth would fit into. Using credible sources, such as .edu, try to find examples or definitions of the genre you choose. After you have done that, look for at least five examples from the novel that fit into the category. The writing you will submit will include:the definition or characteristics of the genre you think the novel fits ina list of five examples from the novel that support the idea that this novel fits into the genre you found Project Option 1-Individually 1 Change the equation to slope intercept form identify the slope and y-intercept of the equation. Be sure to show all your work 2 Describe how you would graph this line using the slope intercept method Be sure to write using complete sentences 4 Graph the function On the graph make sure to label the intercepts. You may graph your equation by hand on a piece of paper and scan 5 Suppose Saf's total profit on lunch specials for the next month is $1.503. The profit amounts are the same $2 for each sandwich and S graphs of the functions for the two months are similar and how they are different 02.03 Key Features of Linear Functions-Option 1 Rubric Requirements Student changes equation to slope-intercept form Student shows all work and identifies the slope and y-intercept of the equation Student writes a description which is clear precise, and correct, of how to graph the line using the slope-intercapt method Student changes equation to function notation Student explains clearly what the graph of the equation represents Student graphs the equation and labels the intercepts correctly Student writes at least three sentences explaining how the graphs of the two equations are the same and how they are different Question 5 (1 point) What best describes the following statements? Statement 1: Smith believed that countries should trust in comparative advantage a decision framework and only restrain trade in a fe the current in a circuit is 0.59 A. The circuit has two resistors connected in series: one is 110 ohms and the other is 130 ohm. What is the voltage in the circuit? Behaviourist theory.meaning of theoryproponentprinciples What compromise created a bicameral legislative branch? What is the exponential function for bacterial growth? PLLEAS HELP SOMEONE I NEED QUICKKSSSS 9. A segment has endpoints at A(-4,2) and B(2,10) . The perpendicular bisector of AB passes through point M, which lies on AB Find the coordinates of 'point M.(pls n ty) what is the negative tu command for dedicar? Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose?