Cells actively involved in secreting proteins would contain large numbers or quantities of ________.

Answers

Answer 1

Cells producing huge portions of proteins would have numerous nucleoli.  One potential explanation that the proteome is such an ample deal bigger than the genome is that mRNAs can be grafted in elective ways in this manner expanding the Digi of items paid from a clear rate.

Ribosomes are especially plentiful in cells that orchestrate a lot of protein. For instance, the pancreas is answerable for making a few stomach-related catalysts and the cells that produce these compounds contain numerous ribosomes.

Cells that successfully produce proteins have various ribosomes in the cytoplasm, which give it a dull blue tone (basophilia) when stained with Wright stain. Cytoplasmic basophilia is especially unmistakable in erythroid forerunner cells when hemoglobin and other cell parts are effectively orchestrated.

To learn more about Cells here

https://brainly.com/question/30046049

#SPJ4


Related Questions

4. Darwin and Lamarck agreed that changes in species are linked to
a. genetics
b. environmental conditions
c. use or disuse of physical features
d. acquired characteristics

Answers

The answer is D)acquired characteristics

Which of these is due entirely to inheritance in humans?
A) Endurance
B) Reading Skill
C)Broken Bones
D) Eye Color

Answers

The snorer is b hope this helps

how do microorganisms play a role in decomposition

Answers

Microorganisms are the primary agents of decomposition. Particularly, fungi are considered the major contributors due to their ability to produce specific enzymes and the possibility to access new substrates through hyphae. In this review, we highlighted the role of fungi in decomposition and reconsider the role of bacteria, neglected in the past, identifying key research needs and knowledge. Particular attention is given to the succession of different taxa with different ecological role that are able to use a substrate that undergoes to chemical and structural modifications. The quality of substrates is a critical factor that influences the microbial community together with environmental variables, such as temperature and moisture. However, the microbial community is also able to influence the substrate characteristics.

Answer:

microorganisms are essential for decomposing organic matter and recyling old plants materials.Some bacteria and fungi provide important nutrients to plants like nitrogen and phosphorus

In Deoxyribonucleic acid, cytosine pairs with the nitrogen base is.....

Answers

It pairs with Guanine

A tumor in a male patient is preventing the anterior pituitary from secreting LH. What effect will this have on his sperm production

Answers

Answer:

He will have a decreased amount of testosterone and in turn a reduction in sperm production.

Create offspring with a few different levels of Food supply. How does food supply affect the body type of offspring?

Answers

Food supply affects body type of offspring by providing resources for growth, lack of it can cause malnourishment and smaller size.

Food supply can have a significant impact on the body type of offspring. When food is abundant, offspring may have the resources to grow larger and develop more muscle mass. Conversely, when food is scarce, offspring may be smaller and have less muscle mass as they do not have access to as many resources for growth. Additionally, if the food supply is inadequate, the offspring may be malnourished and have health problems. It is also worth noting that genetic factors also play a role in determining body type, so food supply may not be the only factor influencing the body type of offspring.

To know more about malnourishment click below:

https://brainly.com/question/2954761#

#SPJ4

what system works with the respiratory system to circulate blood and oxygen throughout the body

Answers

The cardiovascular system works with the respiratory system to circulate blood and oxygen throughout the body. The cardiovascular system includes the heart, blood vessels, and blood.

The cardiovascular system works in conjunction with the respiratory system to ensure that oxygen is delivered to the body's cells and that carbon dioxide is removed. When we breathe in, oxygen enters the lungs and is transferred to the blood, where it binds to hemoglobin. The oxygen-rich blood is then pumped by the heart to the body's cells, where it is used to produce energy. At the same time, respiratory system carbon dioxide, a waste product of cellular metabolism, is removed from the cells and carried cardiovascular system by the blood to the lungs, where it is exhaled. This process, known as respiratory system, is a continuous respiratory system cycle that ensures the body's cells receive the oxygen they need to function properly and that waste products are removed.

learn more about respiratory system here:

https://brainly.com/question/2619922

#SPJ4

Which of the following kingdoms are NOT heterotrophs?
O plants
O fungi
O animals
O all of the kingdoms are made of heterotrophs

Answers

The correct answer is plants
Plants are autotrophs which mean they can make their own food.

By definition
Heterotrophs: an organism deriving its nutritional requirements from complex organic substances.
Autotrophs: an organism that is able to form nutritional organic substances from simple inorganic substances such as carbon dioxide.

Hope this helps

Portland cement is the most common type of cement used in the world. It is made of limestone and other material. It was first developed in 1756 by John Smeaton Portland. Cement is made through a process of heating and grinding. It sets in hardens is with mix with water.. what is the correct statement about Portland cement?

Answers

The statement that is correct is that; Portland is not a mineral because minerals are not man-made. Option C

What is the Portland cement?

We can see that the Portland cement is the product of a kind of a chemicals reaction. In this reaction, there is the combination of the water and the limestone and the mixing is what does produce the Portland cement.

We know that Portland cement is the most common type of cement used in the world. It is made of limestone and other material. It was first developed in 1756 by John Smeaton Portland.

The development of the Portland cement was a mile stone in the rea of the building and the construction industry as we know it today in the whole world. The production of the cement makes it to be hard and then able to survive harsh conditions in usage.

Learn more about Portland Cement:https://brainly.com/question/14804956

#SPJ1

Missing parts;

Use the definition of minerals to choose the correct statement about Portland cement.

Portland cement is the most common type of cement used in the world. It is made of limestone and other material. It was first developed in 1756 by John Smeaton. Portland cement is made through a process of heating and grinding. It sets and hardens when mixed with water.

A

Portland cement is a mineral because all minerals are made of limestone.

B

Portland cement is a mineral because all minerals harden when mixed with water.

C

Portland is not a mineral because minerals are not man-made.

D

Portland cement is not a mineral because minerals aren’t used in daily life.

Drag the organelle labels to the appropriate pink targets. Then identify the function of each organelle on the blue target


Please help meeee I really need help i need to turn it in

Answers

A. the nucleus stores genetic information B. the plasma membrane controls transport

C. the cytoskeleton provides support

D. the golgi processes proteins

E. lysosome: disintegration and recycling

f. flagellum - motion

g. The mitochondrion, which produces energy.

Cell organelles are the collective name for the cellular building blocks. These cell organelles, which are present in the cells and differ in their forms and functions, comprise both membrane-bound organelles and organelles that are not membrane-bound.

For the cell to function normally, they efficiently coordinate and work together. Some of them work by giving shape and support, while others help a cell move and reproduce. The cell has a variety of organelles, which are divided into three groups based on whether or not they have a membrane.

For more information on cell organelles kindly visit to

https://brainly.com/question/17994377

#SPJ4

What is the probability that a child born to two carriers of a recessive disorder allele will have the disorder?

Answers

The probability that a child born to two carriers of a recessive disorder allele will have the disorder is 25% can be calculated by the pedigree analysis.

When two carriers of a recessive disorder allele have a child, each parent will pass on one of their two copies of the allele to the child. Since each parent is a carrier, there is a 50% chance that the child will inherit one copy of the allele from each parent. When both copies of the allele are inherited, the child will have the disorder because the disorder only occurs when both copies of the allele are present.

The probability that the child will inherit one copy of the allele from each parent is (1/2) x (1/2) = 1/4 = 25%. Therefore, the probability that a child born to two carriers of a recessive disorder allele will have the disorder is 25%.

To know more about Pedigree analysis, click here,

brainly.com/question/14525981

#SPJ4

What Is a Siamese Fighting Fish and it's average lifespan in captivity?

Answers

Answer:

The siamese fighting fish (also commonly known as betta fish) is a freshwater fish found in some parts of asia. They are known to fight other fish of their kind, hence the name siamese fighting fish. They usually live between 2-5 years in captivity.

Compare the overall excretory process in plants vs animals in terms of ; organs used and are they specialized?

Answers

Answer:

Stomata.

Explanation:

Plants do not have specialized excretory organs like animals. The plant body produces excess carbon dioxide and oxygen which are excreted from the plant through the small opening present on the underside of the leaves called stomata. In the process of photosynthesis, plant produces oxygen and glucose in which glucose is stored in the body whereas oxygen releases through stomata while on the other hand, in respiration process, plant produces carbondioxide gas that is also released through stomata.

looking at model 1, the other molecules that appear to be high potential energy molecules (free energy carriers) during cellular respiration to carry electrons to oxidative phosphorylation are

Answers

The additional compounds that seem to be high potential energy molecules for transporting electrons to oxidative phosphorylation during cellular respiration include The majority of ATP molecules created during cellular respiration come from oxidative phosphorylation.

The process through which organisms combine oxygen and food molecules, direct the chemical energy of those components toward life-sustaining processes, and eliminate carbon dioxide and water as waste is known as cellular respiration.

The process of breaking down sugar in the presence of oxygen and releasing energy in the form of ATP is known as cell respiration, and it takes place in the mitochondria of living things (animals and plants). Water and carbon dioxide are emitted as waste during this procedure.

Through the mitochondrial electron transport chain, ATP production is connected to electron transfer and corresponding oxygen consumption through the process of oxidative phosphorylation.

For such more question on cellular respiration.

https://brainly.com/question/14158795

#SPJ4

Which of these haploid strains produce permease constitutively but do not produce β-galactosidase
a. I+ P+ O+ Z- Y-
b. I+ P+ O- Z+ Y+
c. I- P+ O+ Z-Y+
d. I- P+ O+ Z+ Y-
e. I- P+ O+ Z+ Y+

Answers

The answer is : I- P+ O+ Z-Y+

The lac operon genes, which encode vital enzymes for lactose absorption and processing, must be expressed for the bacteria to utilise lactose. E. coli should only express the lac operon when two conditions are met in order to be as effective as possible:

Glucose is not readily available, but lactose is.

The Y gene  codes for lactose permease.

In the operon I- P+ O+ Z-Y+, I codes for repressor protein, therefore I- implies this lacks repressor means operon is not inhibited so it is always active

Z codes for beta-galactosidase in this operon.

This haploid species can produce permease persistently but do not produce -galactosidase since this operon has no functioning Z gene but does have a functional Y gene.

So the answer is : I- P+ O+ Z-Y+

To know more about Lac operon here:

https://brainly.com/question/29737281#

#SPJ4

Which of the following is an example of the cycling of matter?
A A sea star dries out when exposed to air and radiation from the sun
B Seaweed releases oxygen that a crab breathes in through its gi is.
C A wave crashes against rock on the shoreline,
D Amussel seals its shell from drying heat of the sun

Answers

Answer:

d

Explanation:

sana maka tulong

The answer is c hope this helps

What event is shown in the diagram?

Answers

This is the depiction of a solar eclipse

What will happen to enzyme if active site loses its shape?

Answers

The substrate's affinity for binding will decline, causing the enzyme to either complete the reaction at a slower rate than usual or not at all, depending on how much the active site has changed.

Proteins known as enzymes serve as biological catalysts and speed up chemical reactions. Substrates are the substances that interact with enzymes, and the enzyme changes the substrates into products, which are other molecules. Enzyme catalysis is required for the bulk of cellular metabolic processes to proceed at speeds quick enough to support life. An enzyme is required for each step in the catalysis of metabolic processes. It is acknowledged in the fields of pseudoenzyme analysis, enzymeology, and the study of enzymes that some enzymes have evolved without the capacity to perform biological catalysis. Their strange "pseudocatalytic" abilities and amino acid sequences often reflect this.

To learn more about Enzyme click on the given link: https://brainly.com/question/14953274

#SPJ4

Blocks of genetic material that do not recombine and are passed on for generations are called
a) phenotypes b) genotypes c) karyotypes d) haplotypes

Answers

Blocks of genetic material that do not recombine and are passed on for generations are called haplotypes.

A haplotype is a set of DNA variants along a single chromosome that tend to be inherited together. Because they are close together on the chromosome and recombination between these variants is rare, they are usually inherited together.

The haplotypes represent sequences along the chromosome that are either conserved intact or separated over time by recombination. This basic concept has led to the development of methods to extract information about recombination to help researchers identify disease-causing genes and loci.

In the genome, alleles of closely spaced variants on the same chromosome tend to occur together more frequently than would be expected at random. These allelic blocks are called haplotypes.

For more information on haplotypes , visit :

https://brainly.com/question/29813074

#SPJ4

Which mutation caused Lucy immunodeficiency disease?

Answers

Hyper IgE syndrome, Job's syndrome is a rare condition with symptoms Lucy's had. A STAT3 gene mutation is the primary cause of the immunodeficiency, which affects approximately one person in a million.

In every tissue of the body, the STAT3 protein is active. It is necessary for life and plays a significant role in the growth and operation of many bodily systems. Signals for the maturation of immune system cells, particularly T cells and B cells, are transmitted by the STAT3 protein in the immune system. Additionally, the protein plays a part in cellular processes that support allergic reactions and is involved in the regulation of inflammation, one of the immune system's responses to infection or injury.

Learn more about mutation here:

https://brainly.com/question/17130462

#SPJ4

Classifying and Exploring Life Lesson 1. Characteristics of Life Lesson 2. Classifying Organisms Lesson 3. Identifying a Beetle Lesson 4. Exploring Life Lesson 5. Constructing a Dichotomous Key

Answers

There appear to be five different lesson topics related to studying life, its characteristics, and to classify and identify different organisms.

"Characteristics of Life," would likely cover the basic characteristics that all living things share, such as the ability to grow, reproduce, and respond to their environment.

"Classifying Organisms," would likely cover how scientists group and classify living things into different categories based on their characteristics, such as the use of taxonomy and the classification system proposed by Carl Linnaeus.

"Identifying a Beetle," would likely focus on teaching students how to identify different species of beetles by their physical characteristics, such as size, shape, and coloration.

"Exploring Life," would likely focus on introducing students to the diversity of life on Earth and the different ways in which living things interact with each other and their environment.

"Constructing a Dichotomous Key," would likely teach students how to use a dichotomous key, which is a tool that helps identify different species by asking a series of questions and narrowing down the options based on the answers.

To know more about classification visit :

https://brainly.com/question/1620211

#SPJ4

Which of the following conclusions about the radiolabeled amino acid is best supported by the results of the experiment

Answers

It was largely integrated into proteins that control and oversee metabolic processes.

Amino acid molecules comprise proteins. Proteins and amino acids are the building blocks of life. After proteins have been digested or denatured, amino acids are still present. In order to maintain the body, the human body makes proteins from amino acids:

The body can produce energy from amino acids to digest food, grow, repair bodily tissue, and carry out a variety of other bodily functions.

Amino acids are divided into three groups:

Important amino acids

Unneeded amino acids

conditional amino acids

Amino acids are necessary for the synthesis of body protein as well as other essential nitrogen-containing compounds like creatine, peptide hormones, and certain neurotransmitters. Even though allowances are portrayed as meeting biological needs, amino acids.

For more information on amino acid kindly visit to

https://brainly.com/question/28409615

#SPJ4

Which of the following processes involves the endocrine system and digestive system working together?
When the hand touches hot food, it is quickly moved away.
Oxygen is carried to blood cells as food is digested in the stomach.
Hormones stimulate the pancreas to release enzymes needed to break down food.
The brain sends signals to the muscles to chew food.

Answers

Endocrine system is involved in the production of some chemicals called as hormones and releasing them to blood stream. Hormones stimulate the pancreas to release enzymes needed to break down food is the processes that include the endocrine system and digestive system coordinate together.

What are hormones?

Hormones are chemical messengers which is involved in the control and coordination of the body.

These are secreted by endocrine glands. Cholecystokinin is the hormone that helps the pancreas to release enzymes.

Here it can be taken as an example where endocrine system and digestive systems are coordinating with each other.

Thus, the correct option is C.

For more details regarding the endocrine system, visit:

https://brainly.com/question/3534540

#SPJ2

INTRO TO CELL RESPIRATION OVERVIEW POGIL: All cells need energy all the time, and their primary source of energy is ATP. The methods cells use to make ATP vary depending on the availability of oxygen and their biological make-up. In many cases the cells are in an oxygen-rich environment. For example, as you sit and read this sentence, you are breathing in oxygen, which is then carried throughout your body by red blood cells. But, some cells grow in environments without oxygen (yeast in wine-making or the bacteria that cause botulism in canned food), and occasionally animal cells must function without sufficient oxygen (as in running sprints). In this activity you will begin to look at the aerobic and anaerobic processes that are used by all organisms to produce ATP. Which statement is NOT true based on this intro

Answers

The products formed as a result of cellular respiration are ATP, water and carbon dioxide.

The cells require energy to perform all their cellular functions. The source of energy for them is ATP which is adenosine triphosphate. The amount of ATP which is produced by a cell depends on its requirement and also on the amount of oxygen that is available.  

Depending on whether a particular organism requires oxygen or not, they can be classified as aerobic and anaerobic. Aerobic organisms are the ones which require oxygen whereas anaerobic organisms do not require oxygen. The reaction for cellular respiration can be represented as:

C₆H₁₂O₆ + 6O₂ → 6CO₂ + 6H₂O + ATP

Carbon dioxide, water and ATP are formed as products in this reaction.

To know more about cellular respiration are

https://brainly.com/question/12320031

#SPJ4

What is represented by
region on the sound
wave

Answers

Answer:

Compressions and Rarefactions

A vibrating tuning fork is capable of creating such a longitudinal wave. As the tines of the fork vibrate back and forth, they push on neighboring air particles. The forward motion of a tine pushes air molecules horizontally to the right and the backward retraction of the tine creates a low-pressure area allowing the air particles to move back to the left.

Explanation:

These regions are known as compressions and rarefactions respectively. The compressions are regions of high air presure while the rarefactions are regions of low air pressure.

Sound waves can also be shown in a standard x vs y graph, as shown here. This allows us to visualise and work with waves from a mathematical point of view. The resulting curves are known as the "waveform" (i.e. the form of the wave.) The wave shown here represents a constant tone at a set frequency.

What can be known about Mendel's five part hypothesis it is an answer to a scientific?

Answers

Mendel established a set of five guiding principles to explain how features are passed down in pea plants, which he called his "five-part hypothesis." The following rules are there are specific "factors" that are transferred from parent to offspring and defining traits.

For each attribute, each parent gives their offspring one component. One factor will be dominant and the other will be recessive when the factors influencing a trait are distinct.

The phenotype will show the expression of the dominant factor but not the recessive factor. A child has a 50% chance of getting a particular trait from a parent.

Mendel's five-part hypothesis has been expanded upon and refined in the century and a half since his initial experiments, but the basic principles he discovered continue to form the foundation of modern genetics. Mendel's work helped establish the concept of the gene as the unit of inheritance and the idea that different versions of a gene (alleles) can result in different traits.

To learn more about Mendel

https://brainly.com/question/11343026

#SPJ4

Could you please help me with this question?

Answers

You’re answer is C. I hope this helps!

What major events happen in each phase of interphase

Answers

Answer:

Explanation:

Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by G2 phase (cell growth). At the end of interphase comes the mitotic phase, which is made up of mitosis and cytokinesis and leads to the formation of two daughter cells.

what are the nutrients which undergo digestion ? just give answer in very simplest form?​

Answers

Protein digestion occurs in the stomach and duodenum in which 3 main enzymes, pepsin secreted by the stomach and trypsin and chymotrypsin secreted by the pancreas, break down food proteins into polypeptides that are then broken down by various exopeptidases and dipeptidases into amino acids.

Answer:

Chemical digestion breaks down different nutrients, such as proteins, carbohydrates, and fats, into even smaller parts:

Fats break down into fatty acids and monoglycerides.

Nucleic acids break down into nucleotides.

Polysaccharides, or carbohydrate sugars, break down into monosaccharides.

Explanation:

Hope it helps u

FOLLOW MY ACCOUNT PLS PLS

List the following units of time from shortest to longest: age,eon,epoch,era,period, and year

Answers

Answer:

year, age, epoch, period, era, eon

Explanation:

The shortest to longest geological time scale units are year, age, epoch, period, era, eon

What is geological time scale?

It is the calendar of Earth's historical events. The time scale sub- divided into units of abstract time  such as eons, eras, periods, epochs, ages, years.

The geologic time scale is measured based on observable characteristics of different layers on rock surface formed during various time periods and fossils present in every layer.

Dating  is the most common method to measure over the time and the most advanced method stratigraphy and geochronology in which any time scale be periodically updated.

Other way to also classify different segment of geological time scale are either by using data of the occurrence of major geologic events and the appearance or disappearance of valuable life-forms.

Hence the correct order from shortest to longest time scale are year, age, epoch, period, era, eon

Learn more about geological time scale, here:

https://brainly.com/question/250441

#SPJ2

Other Questions
please help !!!!!!!! conjugate these three words in the future tense: I will be awarding brainliest for anybody who gets it right, 3 new titles for Insurgent and a paragraph describing why The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers.