Can somone pls help me with this I have a C- in math and I really need help also a like show work on each one plsss

Can Somone Pls Help Me With This I Have A C- In Math And I Really Need Help Also A Like Show Work On

Answers

Answer 1

Answer:

1. [tex]\frac{3}{8}[/tex]

2. [tex]\frac{1}{4}[/tex]

3a. [tex]-\frac{1}{4}[/tex]

3b. 3

3c. [tex]-\frac{4}{5}[/tex]

4. [tex]m = \frac{y_1 - y_2}{x_1-x_2}\\[/tex]

Step-by-step explanation:

1.

Rises 6 inches for every horizontal change of 16 inches

Slope = rise/run

Slope = 6/16

Slope = 3/8

2.

Rises 3 feet for every horizontal change of 12 feet

Slope = rise/run

Slope = 3/12

Slope = 1/4

3a.

[tex]m = \frac{y_1 - y_2}{x_1-x_2}[/tex]

[tex]m = \frac{3-2}{-2-2}[/tex]

[tex]m = \frac{1}{-4}[/tex]

[tex]m = -\frac{1}{4}[/tex]

3b.

[tex]m = \frac{y_1 - y_2}{x_1-x_2}\\[/tex]

[tex]m = \frac{-1 - 2}{-1-0}[/tex]

[tex]m = \frac{-3}{-1}[/tex]

[tex]m = 3[/tex]

3c.

[tex]m = \frac{y_1 - y_2}{x_1-x_2}\\[/tex]

[tex]m = \frac{1 - (-3)}{-1-4}\\[/tex]

[tex]m = \frac{4}{-5}\\[/tex]

[tex]m = -\frac{4}{5}[/tex]

4.

[tex]m = \frac{y_1 - y_2}{x_1-x_2}\\[/tex]


Related Questions

Can someone help me plsssss I’ve been struggling

Answers

I can’t see it








.........

Answer: YES

REASON: Since a rectangle is made of two right triangles then a rectangle inscribed in a circle must have its diagonal as the diameter of the circle.

A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot.

Answers

Answer:

22.4

Step-by-step explanation:

delta math

Answer:22.4

Step-by-step explanation:

Which of the following represents the factorization of the binomial below?
81x2 – 25y2
A. (9x - 5y)(9x - 5y)
B. (9x - 5y)(9x + 5y)
C. (9x - y)(x + 5y)
D. (9x + 5y)(9x + 5y)

Answers

Answer:

B. (9x - 5y)(9x + 5y)

Step-by-step explanation:

when you are factoring these, when you have a negative and a positive, there is a number that will cancel. in this case, when distributing the factors, the number 45xy and -45xy come up. those cancel.

The angles below are complementary. Find the value of X​

Answers

67 decrease because is an angle with 90 decrease angle so 90 - 23 = 67

In a rectangular prism, given a base area of 64 cm2 and a
height of 7.2 cm, what would be the volume of the
figure?

Answers

Answer:

46.8 cm^3

Step-by-step explanation:

Find the measure of <5.
45 = [?]
69%
25

Answers

Answer:

Solution given:

<5+69°=180°[co- interior angle]

<5=180°-69°=111°

<5=111°

What is the original price of a pair of shoes if there is a 5% discount and the sale price is $47.03?

Answers

Answer:

$49.51

Step-by-step explanation:

100-5(the discount) =95%equate 95%=47.03 what about 100%(100%×47.03)÷95$49.51 ans

The original price of the shoes is  $49.50.

What is the discount?

The pricing scheme in which the cost of a thing (or service) is less than its marked price listed price is referred to as a "discount." Simply put, a discount represents a percentage off the advertised price. In consumer interactions, a discount is a type of product price reduction where customers have suggested a percentage of rebates on various goods to increase sales.

Given discount = 5%

sale price  = $47.03

to find original price

discount is given by

Discount (percentage) = (List Price - Selling Price)/ List Price x 100

5% = 1 - SP/LP

SP/LP = 1 - 5%

47.03/LP = 1 - 5/100

LP = (47.03 x 100)/95

LP = $49.50

Hence the original price of the shoes is $49.50.

Learn more about discount;

https://brainly.com/question/3541148

#SPJ2

PLS HELP THIS IS DUE IN AN HOURRRR

Answers

Answer:

i dont know but i really hope you get it right good luck man

Step-by-step explanation:

in a field
number of sheep : number of cows = 10:3
Zak says,
"There are 10 sheep in the field."
Give a reason why Zak could be wrong.

Answers

He can be wrong because the ratio is 10 to 3. They can be 30sheep and 9 cows

What is the missing value?
54
30%
100%
?

Answers

Answer:

54

Step-by-step explanation:

3(x-5) = 2(x-5)+x true or false?

Answers

Answer:

FALSE

Step-by-step explanation:

In order to solve this equation,

First, we must write it out

3(x - 5) = 2(x - 5) + x

Then, we must use the Distributive Property

3x - 15 = 2x - 10 + x

Next, we must Combine Like Terms

3x - 15 = 3x - 10

Finally, we can Subtract The Coefficients

-15 = -10

Because -15 does not equal to -10, this equation has no solution

IT IS FALSE

if you have more questions, comment me below or add another question

GIVING OUT BRAINLIEST ANSWER !! PLS HELP ME OUT !! (last minute)

Answers

Answer:

iḿ pretty sure it´s A, 29.7 !!

Step-by-step explanation:

Need help fast please

Answers

Answer:

1. 53 97 159

2 6 and 6.1

3. 1 1/3

Room's volume is 600 m^3. There is 800 ppm (parts per million) of CO2 in the room.
Fresh air, with the CO2 concentration of 400 ppm starts flowing into the room at the rate of 40 m^3/min. The pressure in the room is constant, so an equal amount of stale air flows out as fresh air flows in, and the CO2 is evenly distributed.
a) Form the differential equation for the amount of CO2 in the room.
b) Solve this differential equation
c) What is the CO2 concentration of the room after fresh air has been flowing in for 30 minutes?

Answers

Answer: C

Step-by-step explanation: Hope this help :D

the equation for this line of best fit is shown below, where d is the distance in miles and f is the fare in dollars.

f = 0.1d + 100



Which of these is a correct interpretation of the slope of this line?



A.
The fare increases $10 for every additional mile

B.
The fare increases $0.10 for every additional 100 miles

C.
The fare increase $0.10 for every additional mile

Answers

Answer:

C

Step-by-step explanation:

the .1 is how much it increases per mile

so .10 a mile increase

quiz consists of 20 multiple choice questions, each with five possible answers, only one of which is correct. If a student guesses on each question, what is the mean and standard deviation of the number of correct answers?
mean: 4; standard deviation: 1.78885438
mean: 10; standard deviation: 1.78885438
mean: 4; standard deviation: 2
mean: 10; standard deviation: 3.16227766

Answers

Answer:

I think mean 10; 3.16

Step-by-step explanation:

Each student in Mr.Carey’s class donated 15$ to a charity. There are 24 students in the class which expression could have been used to calculate the total amount donated?

Answers

$15 x 24 = $360
Hope this helps

Huiling bought 18 chicken nuggets.
She ate 6 of them.
What fraction of the chicken nuggets did she eat?
Give your answer in its simplest form.​

Answers

Answer:

2/3

Step-by-step explanation:

I think that's the answer.

Workers at the Pythagorean Construction Company are building a new house. They need to make sure that proper right triangles are formed to ensure that a safe house is built. What statement should the builders use to ensure that right triangles are formed? If the sum of the two shorter sides equals the longest side, then the triangle is a right triangle. If the sum of the squares of the two longer sides equals the square of the shortest side, then the triangle is a right triangle. If the sum of the squares of the two shorter sides equals the square of the longest side, then the triangle is a right triangle. If the difference of the squares of the two shorter sides equals the square of the longest side, then the triangle is a right triangle.

Answers

Answer: C.) If the sum of the squares of the two shorter sides equals the square of the longest side, then the triangle is a right triangle.

Step-by-step explanation: i hope this helps! :)

The correct statement is (C)

What is Pythagoras theorem?

The Pythagoras theorem states that if a triangle is right-angled (90 degrees), then the square of the hypotenuse is equal to the sum of the squares of the other two sides.

The Pythagoras theorem equation is expressed as, c2 = a2 + b2, where 'c' = hypotenuse of the right triangle and 'a' and 'b' are the other two legs. Hence, any triangle with one angle equal to 90 degrees produces a Pythagoras triangle and the Pythagoras equation can be applied in the triangle.

example:

The hypotenuse of a right-angled triangle is 16 units and one of the sides of the triangle is 8 units. Find the measure of the third side using the Pythagoras theorem formula.

Given : Hypotenuse = 16 units

Let us consider the given side of a triangle as the perpendicular height = 8 units

On substituting the given dimensions to the Pythagoras theorem formula

Hypotenuse2 = Base2 + Height2

162 = B2 + 82

B2 = 256 - 64

B = √192 = 13.856 units

So, Using the definition of Pythagoras theorem

the statement would be

If the sum of the squares of the two shorter sides equals the square of the longest side, then the triangle is a right triangle.

Learn more about pythagoras theorem here:

brainly.com/question/343682

#SPJ2

Six pounds of strawberries cost $11.94. Determine the unit rate and use it to find the price of eight pounds of strawberries.

Answers

Answer:

The unit rate is $1.99. The price of eight pounds of strawberry $15.92.

Step-by-step explanation:

To find the unit price, you divide $11.94 by 6 and you get $1.99. For eight pounds, multiply $1.99 with 8 and you get $15.92.

Answer:

$15.92

Step-by-step explanation:

First find the price of one pound. 11.94÷6=1.99 Once you find the price of 1 pound. You multiply the price of one pound 8 times. 1.99×8=15.92 Hope it helps!


Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years.

Answers

Answer:

what is the question?

Step-by-step explanation:

What is the distance between (-5, -8) and (-1, -16)

Answers

(4,-8)

Step-by-step explanation:

from -5 to -1 you would have to count from 1 to 4. and do the same for -8 to -16

Mike wants to find the confidence interval for a set of data. He knows the sample size and the sample proportion. Which other piece of information does he need to determine the confidence interval?

A.
the critical value
B.
the number of favorable responses
C.
the standard error of the mean
D.
the standard deviation

Answers

Is D,,,,,,,,,,,,,,,,,,

Which is typically the only way to purchase a car and receive

a warranty? a. Dealership

b. Auction

c. Used Car lot d. Private Seller.

Answers

the answer is
a. Dealership

A rectangular prism with a square base has height 12 ft. The volume of the prism is 3468 cubic feet. Determine the side length of the base of the prism to the nearest foot?? what is the answer to this

Answers

Answer:

lo bueno de tener esta app

Given X=[b a 4 a], Y=[c d a b], and Z=[a c 16 b]. What is Y if x-2y=z?

Answers

Answer:

A

[2, -4, -6, -2]

Step-by-step explanation:

If y = 4x, x = 2z, and z = 3a, what is the value of y - x in terms of a?
A) -20a
B) -18a
C) 6a
D) 18a
E) 20a
With steps please

Answers

Answer:

D) 18a

Step-by-step explanation:

y - x

= 4x - x (plug y = 4x)

= 3x

= 3(2z) (plug x = 2z)

= 6z

= 6(3a) (plug z = 3a)

= 18a

Could I get some help here
I literally have the iq of a 2nd grader

Answers

Answer:

x = 16

Step-by-step explanation:

Supplementary angles = 180

K + L = 180

137 + 3x - 5 = 180

132 + 3x = 180

3x = 180 - 132

3x = 48

x = 48/3

x = 16

Each week, the Pickering Trucking Company randomly selects one of its 30 employees to take a drug test. Write an application that determines which employee will be selected each week for the next 52 weeks. Use the Math.random() function explained in Appendix D to generate an employee number between 1 and 30; you use a statement similar to:

Answers

Answer:

In Java:

import java.util.Random;

public class Main{

public static void main(String args []){

  int Employee;

  for(int weeks = 1;weeks<=52;weeks++){

    Employee = 1 + (int)(Math.random() * 30);

    System.out.println("Week "+weeks+" selected employee: "+Employee);

  }

}

}

Step-by-step explanation:

This imports the Random package into the program

import java.util.Random;

public class Main{

public static void main(String args []){

Declare employee as integer (represents employee 1 to 30)

  int Employee;

Iterate from week 1 to 52

  for(int weeks = 1;weeks<=52;weeks++){

Randomly select an employee from 1 to 30 (inclusive)

    Employee = 1 + (int)(Math.random() * 30);

Print the selected employee

    System.out.println("Week "+weeks+" selected employee: "+Employee);

  }

}

}

What ions combine together to form
water in a neutralization reaction?

Answers

Answer: it's H^+ and OH^- ions

Step-by-step explanation:

Other Questions
what is the x-intercept? Micheal home is 12 feet below and his mother's home is 12 above sea levelMicheal says their homes are elevations because they are in opposite directions Is he correct? Explain. When did the agency say something would be stolenBy evening In the afternoonIn the eveningAt 5:30pmThe answer is by evening Do you believe athletes need to be involved in social change? Why? Help me with this problem please please:):) Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain.