Based on your review of the Bradbury et al. (2005) paper,
explain why editing a non-aromatic rice to make it aromatic would
be easier than making an aromatic rice non-aromatic.

Answers

Answer 1

As stated in the article by Bradbury et al. (2005), editing a non-aromatic rice to make it aromatic is easier because only the inactivation of a single gene would be required.

The Bradbury et al. (2005) paper explains that the production of the aromatic compound 2-acetyl-1-pyrroline (2AP) in rice is controlled by a single gene called the "badh2" gene.

In aromatic rice varieties, this gene is either non-functional or has a deletion, leading to the production of 2AP and the characteristic aroma. In non-aromatic rice varieties, the "badh2" gene is functional and prevents the production of 2AP.

Therefore, editing a non-aromatic rice to make it aromatic would be easier because it would only require the inactivation or deletion of a single gene. On the other hand, making an aromatic rice non-aromatic would require the insertion of a functional "badh2" gene, which is a more complex process.

See more about gene inactivation at https://brainly.com/question/28616779.

#SPJ11


Related Questions

How does DNA Polymerase/RNA Polymerase know what nucleotides to polymerize during DNA replication/transcription?

Answers

DNA polymerase and RNA polymerase are enzymes responsible for polymerizing nucleotides during DNA replication and transcription, respectively. Both enzymes use a template strand of DNA to synthesize a complementary strand of RNA or DNA, respectively.

What does the sequence of template provide ?

The sequence of the template strand of DNA provides the information needed for DNA or RNA polymerase to know what nucleotides to polymerize.

DNA polymerase reads the sequence of the template strand of DNA and selects the corresponding nucleotide to add to the growing complementary strand. Similarly, RNA polymerase reads the sequence of the template strand of DNA and selects the corresponding ribonucleotide to add to the growing RNA strand.

The nucleotides are selected based on the base-pairing rules, which dictate that adenine (A) pairs with thymine (T) in DNA, and with uracil (U) in RNA, and that cytosine (C) pairs with guanine (G).

Therefore,  By following these rules, the enzymes ensure that the new DNA or RNA strand is complementary to the template strand and that the genetic information is faithfully transmitted from one generation to the next.

Learn more about DNA polymerase at :

https://brainly.com/question/14315652

#SPJ9

This S-shaped graph is an example of which type of population growth?
A.Logistic

B.Emigration

C.Immigration

D.Exponential

Answers

In logistic growth, a citizenry's rate of per capita growth declines as it approaches the carrying capacity, a limit imposed by the environment's limited resources ( K).

The correct statement is A.

What does logistic growth mean in practice?

Sheep & harbor seals are a couple of examples from wild populations (Figure 19.6b). Both instances show a population size that briefly exceeds the carrying limit before falling below it.

What does logistic growth mean exactly?

Logistic is derived from greek Greek logistikos (computational). The terms "logarithmic" and "logistic" were interchangeable in the 1700s. Logistics is now also utilized for the movement & supply of troops because computation is required to determine the supplies an army needs.

To know more about logistic  visit:

https://brainly.com/question/29765933

#SPJ1

Cell extracts of a previously uncharacterized organism catalyzes the hydrolysis of ATP, showing Michaelis-Menten kinetics with a Km of 3.5 x 10-5 M and a Vmax of 90 μmol-min-¹.mg-¹. (mg indicated the amount of total enzyme) (a) Calculate the velocity of the ATPase reaction at the following ATP concentrations: (i) S = 0.75 x 10-6 M (ii) S = 2.5 x 10-4 M (iii) S= 0.035 M (b) What would Vmax be in the presence of 0.0015 M concentration of a competitive inhibitor of ATPase that had a K₁ of 0.0015 M?

Answers

At 0.75 x 10-6 M ATP, the velocity of the reaction is 1.78 μmol-min-¹.mg-¹. At 2.5 x 10-4 M ATP, the velocity of the reaction is 63.16 μmol-min-¹.mg-¹. At 0.035 M ATP, the velocity of the reaction is 79.73 μmol-min-¹.mg-¹. Vmax in the presence of 0.0015 M concentration of a competitive inhibitor of ATPase would be 66.8 μmol-min-¹.mg-¹.

We can solve this problems using Michaelis Menten Kinetics.1. Michaelis Menten Equation is given by V = (Vmax [S]) / (Km + [S]), whereV = velocity of the reaction,Vmax = maximum velocity of the reaction,[S] = concentration of substrate,Km = Michaelis Menten constant.

(a)When the concentration of ATP (S) is 0.75 x 10^-6 M,
V = (Vmax [S]) / (Km + [S])V = (90 x 0.75 x 10^-6) / (3.5 x 10^-5 + 0.75 x 10^-6) = 1.78 μmol-min-¹.mg-¹

When the concentration of ATP (S) is 2.5 x 10^-4 M,V = (Vmax [S]) / (Km + [S])V = (90 x 2.5 x 10^-4) / (3.5 x 10^-5 + 2.5 x 10^-4) = 63.16 μmol-min-¹.mg-¹

When the concentration of ATP (S) is 0.035 M,V = (Vmax [S]) / (Km + [S])V = (90 x 0.035) / (3.5 x 10^-5 + 0.035) = 79.73 μmol-min-¹.mg-¹

(b) When the concentration of the competitive inhibitor is 0.0015 M with a K₁ of 0.0015 M,The velocity of the reaction is reduced to half when [S] = K_m = 3.5 x 10^-5 M.With inhibitor, the velocity of the reaction becomes

V = (Vmax [S]) / (Km + [S] (1 + [I] / K_i))V / 2 = (Vmax 3.5 x 10^-5) / (3.5 x 10^-5 + 3.5 x 10^-5 (1 + 0.0015 / 0.0015))1/2 = 1 / (1 + 1) = 0.5Vmax = (V / [S]) x (Km + [S])Vmax = (0.5 x 2.54 x 10^4) / (3.5 x 10^-5 + 2.54 x 10^-4) = 66.8 μmol-min-¹.mg-¹

Thus, Vmax in the presence of 0.0015 M concentration of a competitive inhibitor of ATPase would be 66.8 μmol-min-¹.mg-¹.

More on kinetics is here: https://brainly.com/question/29732051

#SPJ11

What is the probability that two blood type O parents will
produce a child with blood type A?

Answers

The probability that two blood type O parents will produce a child with blood type A is 0%.

This is because blood type O is recessive, meaning that an individual with blood type O carries two copies of the O allele.

In order for a child to have blood type A, they must inherit at least one copy of the A allele from one of their parents. Since both parents have blood type O, they do not carry the A allele and therefore cannot pass it on to their child.

Therefore, the probability of two blood type O parents producing a child with blood type A is 0%.

To know more about blood type click on below link:

https://brainly.com/question/256625#

#SPJ11

A patient who is unable to constrict their pupil & whose medial sclera is exposed most likely has an issue with which CN?

Answers

The patient's issue is likely related to Cranial Nerve III (oculomotor nerve). This nerve is responsible for pupil constriction and movement of the eye muscles.

The oculomotor nerve, often referred to as the third cranial nerve, cranial nerve III, or simply CN III, is a cranial nerve that enters the orbit through the superior orbital fissure and innervates extraocular muscles, which are responsible for most eye movements and eyelid adduction. The nerve also has fibres that innervate the muscles in the intrinsic eye, allowing for pupillary constriction and accommodation (ability to focus on near objects as in reading). The embryonic midbrain's basal plate is the source of the oculomotor nerve. The control of eye movement is likewise mediated by cranial nerves IV.

The oculomotor nerve arises from the third nerve nucleus at the level of the superior colliculus in the midbrain. The third nerve nucleus is placed ventral to the cerebral aqueduct, on the pre-aqueductal grey matter. Then, the red nucleus receives the fibres from the two third nerve nuclei that are laterally situated on either side of the cerebral aqueduct. The oculomotor sulcus, a groove on the lateral wall of the interpeduncular fossa, is where fibres from the red nucleus exit the brainstem and emerge from the brainstem material. At this point, the nerve is covered in a pia mater sheath and contained in an extension from the arachnoid. It travels between the posterior cerebral and superior cerebellar regions (below).

the anterior and lateral dura mater to the posterior clinoid process, travelling between the free and connected boundaries of the tentorium cerebelli. and posterior cerebral arteries (above).

For more such questions on Cranial Nerve , Visit:

https://brainly.com/question/14017653

#SPJ11

Calculate the frac!on of the pep!de that has the C-terminal carboxyl group protonated at pH 2.5. Please report your answer as a percent of protonated C- terminal species rela!ve to all (protonated and deprotonated) C-terminal species. Please use the pKa listed on slide 14 of Lecture 2. Round to 2 decimal points. Please show your work.

Answers

The pKa of the C-terminal carboxyl group is 3.6 (as listed on slide 14 of Lecture 2). To calculate the fraction of the peptide that has the C-terminal carboxyl group protonated at pH 2.5, we can use the Henderson-Hasselbalch equation:


Rearranging the equation to solve for the fraction of protonated species [tex]([HA]/([HA] + [A-])):[/tex]
[tex]< ([HA]/([HA] + [A-])) = 10^{(pKa - pH)} >[/tex]
Plugging in the values for pKa and pH:
[tex]< ([HA]/([HA] + [A-])) = 10^{(3.6-2.5)} > \\ < ([HA]/([HA] + [A-])) = 10^{1.1} > \\ < ([HA]/([HA] + [A-])) = 12.59 >[/tex]
To convert this fraction to a percentage, we multiply by 100:
[tex]< ([HA]/([HA] + [A-])) * 100 = 12.59 * 100 > \\ < ([HA]/([HA] + [A-])) * 100 = 1259 >[/tex]
Therefore, the fraction of the peptide that has the C-terminal carboxyl group protonated at pH 2.5 is 1259%.
To round to 2 decimal points, we can use the following formula:
Therefore, the fraction of the peptide that has the C-terminal carboxyl group protonated at pH 2.5 is 1259.00%.

For more question on Henderson-Hasselbalch equation click on

https://brainly.com/question/17603212

#SPJ11

How did Chargaff’s experiment slime affect the understanding of dna structure?

Answers

Chargaff’s experiment slime affect the understanding of dna structure as they led to discovery that purine form base pairs with pyrimidines.

DNA Chargaff He discovered that the amounts of adenine and guanine were not equal to each other, but that adenine and guanine were equivalent to thymine and cytosine, respectively. A=T=30% and G=C=20% are the approximate percentages.James Watson and Francis Crick's base pair model for the double helix structure was developed using an essential hint from Chargaff's first parity rule, as it is now known. According to a rule discovered by biologists, all double stranded DNA follows this pattern: A binds with T, G binds with C, and so on to form a double helix.Further research by Chargaff revealed that most single-stranded DNA, but not all of it, follows a rough approximation of his rule.

For more information on Discovery of structure of DNA kindly visit to

https://brainly.com/question/30105444

#SPJ1

all cell types except ___ ___ generate only graded, local potentials, affecting each other through the graded release of neurotransmitters.

Answers

All cell types except neurons and muscle cells generate only graded, local potentials, affecting each other through the graded release of neurotransmitters.

Neurons and muscle cells are unique in that they are able to generate action potentials, which are all-or-nothing responses that can travel long distances along the cell membrane. This allows for rapid communication between cells and is essential for processes such as muscle contraction and neural signaling.

Information is transmitted via neurons. They communicate between various brain regions and between the brain and the rest of the nervous system through electrical impulses and chemical signals. The neuron, a specialised cell created to send information to other nerve cells, muscle cells, or gland cells, is the basic functional unit of the brain. Neurons are nervous system cells that communicate information to other nerve, muscle, and gland cells. Axons, dendrites, and a cell body make up the majority of neurons.

For more such questions on  neurons

https://brainly.com/question/6260412

#SPJ11

The third reaction in PDH Complex 1 point is needed for A. Thiol group formation B. Restoration of E3 C. Restoration of E1 D. Restoration of E2

Answers

The third reaction in PDH Complex 1 point is needed for the restoration of E3.

So, the correct answer is B.

This reaction involves the transfer of the electrons from the reduced lipoamide to the oxidized FAD cofactor in the E3 component of the PDH complex, which results in the restoration of the E3 component back to its oxidized state. This is an important step in the overall function of the PDH complex, as it is necessary for the continued oxidation of pyruvate and the production of acetyl-CoA.

FAD is a coenzyme in cellular respiration. Enzymes are biocatalysts produced by cells. Enzymes are composed of apoenzymes and prosthetic groups (cofactors).


Answer: B. Restoration of E3.

Learn more about PDH complex at https://brainly.com/question/15835777

#SPJ11

can i get some help with this please that knows the answer to this thank u
Question 13
What shift in population growth has occurred by Point A?

A: the birth rate and death rates are equal
B: the rate of emigration equals the death rate
C: the population sizes of the organisms and its predator are equalized
D: there will be more food available than the population can consume

Answers

Answer:

A. Birth rate and death rates are equal

Explanation:

Since the graph plateaus this means that the number of organisms in the community has reached the carrying capacity. At this point the environment cannot support more organisms.

What aspects of the experimental design were used to help rule out potentially confounding variables? select all that apply. View available hint(s)for part c the authors designed a field experiment to test the hypothesis that competitive interactions between the closely related a. Segrei (an introduced species) and a. Carolinensis (a native species) would cause a change in the perch height of a. Carolinensis. What aspects of the experimental design were used to help rule out potentially confounding variables? select all that apply. Before a. Segrei was introduced on three islands, perch height data of undisturbed a. Carolinensis on those islands was collected. The perch height of both species was measured multiple times over the three years that scientists conducted the experiment. The non-native species a. Segrei was introduced on three islands by the scientists to observe its effect on a. Carolinensis. Islands of three different sizes were selected (2 large, 2 medium, and 2 small) and the same experiment was run on each pair of islands. Six islands were studied. A. Sagrei was introduced on three of the islands, and the other three islands were used for comparison

Answers

Prior to introducing a. Segrei, data on the perch height of untouched A. Carolinensis were gathered on the three islands.

What was done to account for temporal change?

In order to account for temporal change, the perch height of both species was measured repeatedly over the course of the experiment's three years. By choosing three different-sized islands—two large, two medium, and two small—and doing the identical experiment on each pair of islands, we can take into account any potential effects of island size.

How many island?

Just three of the six islands received the introduction of a. Segrei; the other three served as comparison islands to eliminate any possible island-specific impacts.

To know more about species visit:-

brainly.com/question/13259455

#SPJ1

1. Compare and contrast the electrical properties of the three muscles. (5pts) 2. Compare the speed and suration of contraction in the three muscles (5pts)

Answers

Skeletal muscles have the fastest action potentials and contract quickly, while smooth muscles have the slowest action potentials and contract slowly, and cardiac muscles have moderate action potentials and a longer duration of contraction than skeletal muscles.



1. The three types of muscles in the human body are the skeletal muscle, cardiac muscle, and smooth muscle. The electrical properties of these muscles differ in terms of their action potentials and the speed at which they contract.

Skeletal muscles have the fastest action potentials and contract quicklyCardiac muscles have slower action potentials and contract at a moderate paceSmooth muscles have the slowest action potentials and contract slowly.

2. In terms of the speed and duration of contraction:

Skeletal muscles have the fastest contraction speed and the shortest duration of contractionCardiac muscles have a moderate contraction speed and a longer duration of contraction than skeletal musclesSmooth muscles have the slowest contraction speed and the longest duration of contraction.

Overall, the electrical properties and contraction speed and duration of the three muscles are different, allowing them to perform their specific functions in the body.

Skeletal muscles are used for movement, cardiac muscles are used to pump blood, and smooth muscles are used to control the movement of substances through organs.

To know more about the skeletal muscle click here:

https://brainly.com/question/1560716

#SPJ11

what is the whales closest living relative? Give reasons why you choose this animal?

ANSWER NOW PLEASE!!

Answers

dolphin cuz yeah yeah

Answer:

Hippos and whales may look different in many ways, but they are actually each others' closest living relatives—sharing a common ancestor that lived about 55 million years ago.

a. Write a recurrence equation describing reproduction in a bacterium that can reproduce itself by binary fission. Also write the initial condition that corresponds to saying that the
first term in sequence is 1
b. Use technology to calculate how many bacteria those would be after every 30 minutes till 10 hours, if the bacteria could reproduce itself by binary fission every 30 minutes. Start with one bacterium. You can use Wolfram Alpha by typing in your answer to part (a). You can one bacterium. AK MATTE As it Mathemtica. There is also Mathematica Online. To use these programs you need to convert the problem into the syntax used by these programs.
c. Plot the growth graph for the sequence that satisfies the equations you wrote in part (a).
d. Transform the equation that you got in part (a) into and exponential growth equation, that you learned about in class (of the form N(t) = Noert). Write the value of r in the equation.

Answers

a) The recurrence equation describing reproduction in a bacterium that can reproduce itself by binary fission is A_n = 2A_(n-1)

b)  To calculate how many bacteria there would be after every 30 minutes till 10 hours, we can use the recurrence equation and the initial condition that we found in part (a) and plug them into Wolfram Alpha or Mathematica.

c)  To plot the growth graph for the sequence that satisfies the equations we wrote in part (a), we can use the same recurrence equation and initial condition and plug them into Wolfram Alpha or Mathematica.

d)   To transform the equation that we got in part (a) into an exponential growth equation, we can use the formula  N(t) = Noert



a )The initial condition that corresponds to saying that the first term in the sequence is 1 is:

A_1 = 1



b ) In Wolfram Alpha, we can type in:

RecurrenceTable[{a[n] == 2*a[n - 1], a[1] == 1}, a, {n, 1, 20}]

This will give us the number of bacteria after every 30 minutes till 10 hours (20 terms in the sequence).



c ) In Wolfram Alpha, we can type in:

ListPlot[RecurrenceTable[{a[n] == 2*a[n - 1], a[1] == 1}, a, {n, 1, 20}]]

This will give us a plot of the growth of the bacteria over time.



d ) Where N(t) is the number of bacteria at time t, No is the initial number of bacteria, e is the base of the natural logarithm, and r is the growth rate.

Since the bacteria can reproduce itself by binary fission every 30 minutes, the growth rate is:

r = ln(2)/0.5 = 1.386

So the exponential growth equation is:

N(t) = 1*e^(1.386*t)

And the value of r in the equation is:

r = 1.386

To know more about binary fission click on below link:

https://brainly.com/question/7639952#

#SPJ11

if the left ophthalmic artery demonstrates flow moving toward the transducer while the right demonstrates flow moving away from the transducer, what could be causing the flow reversal?

Answers

If the left ophthalmic artery demonstrates flow moving toward the transducer while the right demonstrates flow moving away from the transducer, the flow reversal in the left ophthalmic artery could be caused by a condition called ocular ischemic syndrome.

Ocular ischemic syndrome occurs when there is a blockage or narrowing in the carotid artery, which supplies blood to the brain and the eyes. As a result, blood flow to the eyes is reduced, causing a reversal of flow in the ophthalmic artery. This can lead to symptoms such as blurry vision, pain, and even vision loss. It is important to seek medical attention if you experience any of these symptoms, as ocular ischemic syndrome can be a sign of a serious underlying condition, such as atherosclerosis or carotid artery disease.

For more such questions on atherosclerosis, click on:

https://brainly.com/question/27222959

#SPJ11

Two broad concepts exist regarding the action of hormones at the cell membrane, based on the chemical structure/composition (polarity) of the hormone. What are the respective mechanisms whereby the "signal" is detected and transmitted intracellularly, eventually affecting DNA transcription? Explain.

Answers

Two broad concepts exist regarding the action of hormones at the cell membrane, based on the chemical structure/composition (polarity) of the hormone. The respective mechanisms whereby the "signal" is detected and transmitted intracellularly, eventually affecting DNA transcription are the water-soluble hormones and the lipid-soluble hormones.

Water-soluble hormones, such as peptide hormones, are polar and cannot pass through the lipid bilayer of the cell membrane. Therefore, they bind to a receptor on the cell membrane, which activates a second messenger system within the cell. This second messenger system transmits the signal intracellularly, eventually affecting DNA transcription.

Lipid-soluble hormones, such as steroid hormones, are nonpolar and can pass through the lipid bilayer of the cell membrane. They bind to an intracellular receptor, which then translocates to the nucleus and binds to specific regions of DNA. This binding affects DNA transcription and the expression of specific genes. In summary, water-soluble hormones transmit their signal through a second messenger system on the cell membrane, while lipid-soluble hormones transmit their signal through an intracellular receptor that directly affects DNA transcription.

Learn more about hormones at:

https://brainly.com/question/14594386

#SPJ11

A sudden reduction in population size due to a change in the environment, resulting in a gene pool quite unlike the original is called:
Select one:
a. Bottleneck effect.
b. Gene flow.
c. Artificial selection.
d. Natural selection.

Answers

A sudden reduction in population size due to a change in the environment, resulting in a gene pool quite unlike the original is called bottle neck effect. The correct answer is A.

The bottleneck effect occurs when a population experiences a sudden decrease in size due to an environmental change, such as a natural disaster or human interference. This results in a gene pool that is significantly different from the original population, as only a small number of individuals survive and contribute to the new population's genetic makeup. This can lead to a loss of genetic diversity and an increase in genetic drift, which can have a significant impact on the population's ability to adapt and survive in the future.

Learn more about Bottleneck effect here: https://brainly.com/question/26318776.

#SPJ11

Tell us about a recent experimental discovery involving DNA. Tell
what the investigators found, and the impact that discovery
has.

Answers

A recent experimental discovery involving DNA was the identification of a new gene that plays a role in the development of Alzheimer's disease. The impact of this discovery is associated with advances in finding new treatments for Alzheimer's disease.

The gene, called TREM2, was found to be mutated in people with a higher risk of developing the disease. The discovery of this gene could lead to new treatments for Alzheimer's and a better understanding of the disease.

The investigators used DNA sequencing techniques to compare the DNA of people with Alzheimer's disease to those without the disease. They found that the TREM2 gene was mutated in a small percentage of people with Alzheimer's, indicating that it could play a role in the development of the disease.

This discovery has the potential to impact the way that Alzheimer's disease is treated and understood. It could lead to new treatments that target the TREM2 gene, and it could also help researchers to identify other genes that may be involved in the development of the disease. Overall, this discovery is an important step forward in the field of Alzheimer's research.

See more about DNA at https://brainly.com/question/16099437.

#SPJ11

Please explain and cite sources if possible. Thank you!
1. What are the 3 major groups of helminths? Explain and give 1
example for each group.

Answers

Helminths are parasitic worms that live in the intestines and other parts of the body. They are categorized into three major groups: 1) Nematodes (roundworms), 2) Trematodes (flukes), and 3) Cestodes (tapeworms).
1) Nematodes (roundworms): These are unsegmented worms with cylindrical bodies. They live in the intestines, lungs, and other tissues. An example of a nematode is Ascaris lumbricoides, which is a roundworm that causes ascariasis, a common intestinal infection in humans.
2) Trematodes (flukes): These are flat, leaf-shaped worms that live in the intestines, liver, and other organs. An example of a trematode is Schistosoma, which is a fluke that causes schistosomiasis, a disease that affects the urinary and intestinal systems.
3) Cestodes (tapeworms): These are segmented worms that live in the intestines. An example of a cestode is Taenia saginata, which is a tapeworm that causes taeniasis, a disease that can lead to abdominal pain, nausea, and diarrhea.
Read more about   parasitic here:https://brainly.com/question/14461672

#SPJ11

Viruses are not living organisms. They are defined as
non-cellular infectious agents having two characteristics. What are
these two fundamental characteristics?

Answers

The two fundamental characteristics of viruses are their ability to replicate only within a host cell and their lack of cellular structure.

Viruses are essentially packets of genetic material, either DNA or RNA, surrounded by a protein coat called a capsid. Some viruses may also have a lipid envelope.

Viruses cannot reproduce or carry out metabolic processes on their own; they require a host cell to replicate and produce new virus particles. Once a virus infects a host cell, it hijacks the cell's machinery to produce more virus particles, which are then released to infect other cells.

Because they lack cellular structure and the ability to carry out life processes, viruses are not considered living organisms.

For more questions like Viruses click the link below:

https://brainly.com/question/30972422

#SPJ11

What do you think would happen if the energy we get from a meal was released all at once?

Answers

If the energy we get from a meal was released all at once, it would be disastrous for our bodies, can cause stroke, hyperglycemia and can have other negative consequences.

First, the sudden release of energy would cause a massive increase in body temperature, potentially leading to heat stroke or other heat-related illnesses and will tremendously increase the blood pressure.

Second, the sudden release of energy would also cause a spike in blood sugar levels, which can lead to hyperglycemia and potentially diabetes.

Finally, the sudden release of energy would likely cause damage to our cells and tissues, potentially leading to organ failure or other serious health problems.

In short, it is important for our bodies to release energy slowly and steadily in order to maintain proper functioning and avoid negative health consequences.

Learn more about metabolism here: https://brainly.in/question/18767980

#SPJ11

What are some credible sources of drug information Kaylyn can use to complete her task?

Answers

Kaylyn can finish her assignment by using a number of reliable sources of drug information. NIDA: National Institute on Drug Abuse, SAMHSA, ASAM, MedlinePlus, and CDC are some resources.

Kaylyn can finish her assignment by using a number of reliable sources of drug information. These sources comprise, among others:

The National Institute on Drug Abuse (NIDA) is a federally funded research organisation that offers in-depth knowledge about drug abuse and addiction.

The Substance Abuse and Mental Health Services Administration (SAMHSA) is a federal organisation that focuses on the prevention and treatment of drug misuse.

The Centers for Disease Control and Prevention (CDC) is a federal organisation that disseminates knowledge about wellness and illness prevention.

MedlinePlus - The National Library of Medicine offers MedlinePlus as a consumer health information service.

A professional society with a focus on addiction medicine is the American Society of Addiction Medicine (ASAM).

Before deciding on any course of drug use or therapy, Kaylyn should speak with a licenced healthcare expert.

Learn more about drug information here:

https://brainly.com/question/9839560

#SPJ4

What is the application of mammalian cell expression system?

Answers

The mammalian cell expression system is a method used in biotechnology to produce recombinant proteins.

The system involves the use of mammalian cells, such as Chinese hamster ovary (CHO) cells, to produce a specific protein of interest. The protein is typically encoded by a gene that is introduced into the mammalian cells using a plasmid or viral vector.

The application of mammalian cell expression system includes:

1. Production of therapeutic proteins: Mammalian cell expression systems are widely used for the production of therapeutic proteins, such as monoclonal antibodies, cytokines, and hormones. These proteins are used for the treatment of various diseases, including cancer, autoimmune disorders, and infectious diseases.

2. Drug discovery and development: Mammalian cell expression systems are also used in drug discovery and development. They are used to produce proteins that are used in high-throughput screening assays to identify potential drug candidates.

3. Basic research: Mammalian cell expression systems are used in basic research to study the structure and function of proteins. They are also used to study protein-protein interactions, protein-DNA interactions, and other aspects of cellular biology.

Overall, the mammalian cell expression system is a valuable tool for the production of recombinant proteins and is widely used in the biotechnology and pharmaceutical industries.

To know more about mammalian cells click on below link:

https://brainly.com/question/19594573#

#SPJ11

What would expect to find on C-fern culture that had a high
density of germinating Wild type (WT) spores, compared to a C-fern
culture which had a low-density of germinating Wild type (WT)
spores?

Answers

By asymmetric cell division, fern spore germination creates a rhizoid and protonemal cell, which later evolve into a gametophyte.

What benefit does the life cycle of the C fern offer?

The fern life cycle has the benefit of integrating an indeterminate and complicated diploid sporophyte with a sizeable free-living haploid gametophyte, which is more amenable to developmental research than the smaller seed plant gametophyte.

What is the title of the structure that the nephrolepis spore develops into?

These spores generate a new structure known as the protothallus upon germination.A small, discrete, multicellular gametocytes structure that is separate from the main plant body is known as a protothallus.

To know more about cell division visit:

https://brainly.com/question/29773280

#SPJ1

What are all of the
differences in the Electron Transport System
between Entamoeba histolytica trophozoite and
Plasmodium falciparum parasites?

Answers

There are differences in the Electron Transport System between Entamoeba histolytica trophozoite and Plasmodium falciparum parasites.

In Entamoeba histolytica trophozoite, the electron transport chain is underdeveloped, and it lacks functional complexes I and III, which are part of the ETC.

Instead, this parasite has a simplified ETC consisting of a single NADH dehydrogenase that transfers electrons to the flavin mononucleotide (FMN) prosthetic group of a disulfide-reducing flavoprotein.

On the other hand, the electron transport chain in Plasmodium falciparum parasites has a modified structure.

Malaria parasites lack many conventional ETC components, and their mitochondrial electron transport chain has some unique features, such as a di-iron protein complex not found in any other eukaryotic ETC.

The respiratory chain is an important part of P. falciparum, driving the formation of the mitochondrial membrane potential and ATP synthesis.

However, the entire complex III of the electron transport chain is absent in this parasite.

Learn more about  Electron Transport System.

https://brainly.com/question/12021821

#SPJ11

From 1 glucose how many f atp would be produced?
for 1 glucose how many h atp would be produced?
For 1 glucose how many c atp would be produced ?

Answers

The process of breaking down glucose to produce ATP is called cellular respiration. It consists of three main stages: glycolysis, the citric acid cycle (also known as the Krebs cycle), and the electron transport chain.

In glycolysis, 1 glucose molecule is broken down into 2 pyruvate molecules, producing a net gain of 2 ATP. The 2 pyruvate molecules then enter the citric acid cycle, where they are further broken down, producing a net gain of 2 ATP. Finally, the electron transport chain produces a net gain of 32 ATP.
So, for 1 glucose molecule, a total of 36 ATP are produced:
2 ATP from glycolysis
+ 2 ATP from the citric acid cycle
+ 32 ATP from the electron transport chain
= 36 ATP
Therefore, the answer to your question is:
- 36 f ATP (from 1 glucose)
- 36 h ATP (from 1 glucose)
- 36 c ATP (from 1 glucose)
For more question on glycolysis click on

https://brainly.com/question/1966268

#SPJ11

help me please im so confused

Answers

The correct response is option D

What is the acquired traits misconception before Mendel?

Before Mendel's work on genetics, there was a common misconception that acquired traits could be passed on from one generation to the next. This idea was known as the theory of inheritance of acquired characteristics, or Lamarckism, named after the biologist Jean-Baptiste Lamarck.

Lamarck proposed that organisms could acquire new traits during their lifetime through the use or disuse of certain organs, and that these acquired traits could then be passed on to their offspring.

Learn more about Mendel:https://brainly.com/question/30602783

#SPJ1

Of the following issues with scientific research prior to modern bioethics, which was NOT mentioned by the textbook as being an issue? a) The research resulted in a high number of casualties. b) Research subjects were often poor or persons of color. c) Researchers only cared about making a profit. d) Researchers did not always get the consent of research subjects.

Answers

The issue with scientific research prior to modern bioethics that was NOT mentioned by the textbook as being an issue is researchers only cared about making a profit.
So, the correct answer is C.

Before modern bioethics, researchers cared about gaining scientific knowledge and understanding, rather than making a profit. However, the other issues mentioned in the question (a) resulting in a high number of casualties, b) research subjects being often poor or persons of color, and d) researchers not always getting the consent of research subjects were all issues prior to modern bioethics.

Answer: c) Researchers only cared about making a profit.

Learn more about modern bioethics at https://brainly.com/question/14446674

#SPJ11

A. -Study in West Africa. 1. Two variables:a. Post-partum sex taboosa) After a women delivers a baby, she must leave her husband and live with her mother for 4 years. B) During that period, no sex between her and her husband. C) The mother becomes the guard between the wife and husband. D) Husband remarries. E) After 4 years, she can return to her husband. B. Low protein diets in culture2. What is he saying? If the diet has low protein, it is more likely that there will be a large gap in post-partum sex taboos. The main source is the milk from the mother, so it becomes longer. If the diet is high protein, the gap is smaller in post-partum sex taboos

Answers

The speaker suggests that low protein diets may lead to longer post-partum taboos in West African cultures, while high protein diets may result in shorter taboos.

Post-partum  taboos are cultural conventions or laws that specify when a woman and her husband can resume having  following the birth of a child. Such taboos can last for years in some West African societies, during which the lady may be required to reside with her mother and refrain from having s with her husband. The mother might serve as a mediator between them, and the husband might even marry someone else at this time. Dietary considerations, such as low protein diets, may lengthen taboo periods since the baby is less likely to have access to protein-rich breast milk as a result of such diets. Sexual conduct is regulated by postpartum taboos.

Learn more about taboos here:

https://brainly.com/question/29795971

#SPJ4

Research all the different ways human reproductive anatomy can
vary. Why do you think that it is the case for each one?

Answers

There are many ways in which the human reproductive anatomy can vary, including differences in genital size and shape, the presence or absence of internal reproductive organs, and variations in hormone production and sensitivity. These variations can arise due to a variety of factors, including genetics, environmental factors, and developmental processes. In some cases, variations in reproductive anatomy may be associated with differences in reproductive function or fertility.

For example, men with smaller testicles may produce less sperm, while women with certain hormonal imbalances may have difficulty becoming pregnant. In other cases, reproductive anatomy variations may not have any functional impact, but may still be subject to social stigma or prejudice. For example, individuals with intersex traits (who have both male and female reproductive anatomy) may face discrimination or prejudice due to their non-binary status. Despite the many ways in which human reproductive anatomy can vary, it is important to recognize that there is no "normal" or "correct" form of human sexuality. Rather, each person's reproductive anatomy is unique, and should be accepted and respected for its inherent diversity and complexity.

To know more about Human reproductive anatomy refer here:

https://brainly.com/question/29841896

#SPJ11

Other Questions
Behaviourist theory.meaning of theoryproponentprinciples What compromise created a bicameral legislative branch? What is the exponential function for bacterial growth? PLLEAS HELP SOMEONE I NEED QUICKKSSSS 9. A segment has endpoints at A(-4,2) and B(2,10) . The perpendicular bisector of AB passes through point M, which lies on AB Find the coordinates of 'point M.(pls n ty) what is the negative tu command for dedicar? Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose? PLEASEEEE HELP ASPPPPP Cambodia rice export to EU countries within EBA (research purpose) 4: 7 and 12 : whats the ratio To organize this text, the author divides it into sections with subheadings. What is described in the section with the subheading "Darwin Is Stumped"? I How does the author's use of the word "assaulted* in paragraph 2 contribute to ourunderstanding of Hitler's propaganda?A.It shows that German citizens would not readily believe propaganda.B.It reveals that German citizens were physically attacked with propaganda.C.It emphasizes that the German government's propaganda campaign wasforceful.D.It shows readers that German citizens didn't like the propaganda they wereexposed to.