assume again that andretti company has sufficient capacity to produce 90,000 daks each year. a customer in a foreign market wants to purchase 20,000 daks. if andretti accepts this order it would have to pay import duties on the daks of $1.70 per unit and an additional $9,000 for permits and licenses. the only selling costs that would be associated with the order would be $3.20 per unit shipping cost. what is the break-even price per unit on this order?

Answers

Answer 1

The break-even price per unit on this order is $19.90. Andretti would need to charge at least this amount per unit to cover their variable costs and the additional costs associated with the order.

How to calculate break even?

To calculate the break-even price per unit on this order, we need to consider the additional costs that Andretti will incur if they accept the order. These costs include the import duties, permits and licenses, and shipping costs.

First, let's calculate the total additional costs:

Import duties per unit = $1.70

Permits and licenses = $9,000

Shipping cost per unit = $3.20

Total additional costs = (Import duties per unit + Shipping cost per unit) x Number of units + Permits and licenses

Total additional costs = ($1.70 + $3.20) x 20,000 + $9,000

Total additional costs = $102,000

Next, we need to calculate the break-even price per unit by adding the additional costs to the variable costs per unit. Since Andretti has sufficient capacity to produce 90,000 daks each year, we can assume that the fixed costs have already been covered by their existing production.

Variable cost per unit = $14.00 (given in a previous question)

Break-even price per unit = Variable cost per unit + Additional costs per unit

Break-even price per unit = $14.00 + ($1.70 + $3.20)

Break-even price per unit = $19.90

To know more about break-even visit:-

brainly.com/question/13770712

#SPJ1


Related Questions

a trade discount is a reduction from the list price, which is to (select all that apply.) multiple select question. encourage customers to pay quickly. change prices without publishing a new catalog. give quantity discounts to customers. reduce the sale price for interest received. disguise real prices from competitors.

Answers

A trade discount is a discount from the list price offered to customers as a perk to get them to buy more or pay right away. It has nothing to do with interest payments or price reductions.

Which of the following is a concession that lowers the total amount due if the consumer pays within a certain time frame?

Discounts for early payments,Offering an early payment discount doesn't affect the price at which the products are sold. Clients may only reduce the overall amount due from you if they pay you within a certain time frame; otherwise, the total amount owing does not change.

Is the transaction price not adjusted for a trade discount?

an industry discountis not considered in the transaction price. Revenue should be recognized when it is earned, and not before. buyer and the seller. purchases.

To know more about trading  visit:-

brainly.com/question/31110053

#SPJ1

ucla is offering a special banquet dinner with live entertainment to season ticket holders of the college football team who have also donated at least $5,000 during the last year to athletic programs at the school. why is ucla most likely incorporating exclusivity in this situation?

Answers

UCLA is incorporating exclusivity in offering a special banquet dinner with live entertainment to season ticket holders who have donated at least $5,000 during the last year to athletic programs at the school in order to incentivize donations and increase revenue for their athletic programs.

Exclusivity is a marketing strategy that is commonly used to create a sense of prestige and desire among customers. In this case, by limiting the offer to a select group of donors, UCLA is creating a sense of exclusivity and privilege, which can motivate others to donate more in order to gain access to the special banquet dinner.

This strategy can be particularly effective in the context of college sports, where there is often a high level of emotional attachment among fans and donors. By offering an exclusive event that is only available to a select group of supporters, UCLA is tapping into the passion and loyalty of its fan base, and creating an incentive for them to increase their support for the athletic programs.

Overall, by incorporating exclusivity into their fundraising efforts, UCLA is likely hoping to increase donations and generate more revenue for their athletic programs, while also strengthening the bond between the university and its most dedicated supporters.

To know more about incentivize donations, refer here:

https://brainly.com/question/3681904#

#SPJ11

If large numbers of individuals choose to behave as free riders, ________.
a. public goods will quickly be privatized
b. more of the public good will be available for paying riders
c. the public good may never be provided

Answers

If large numbers of individuals choose to behave as free riders, the public good may never be provided.

The correct option is c.

A public good is a good or service that is non-excludable and non-rivalrous, meaning that it is difficult or impossible to exclude individuals from using it and one person's use of the good doesn't reduce its availability to others. Because of this, public goods are often undersupplied in a market economy, as individuals may choose to benefit from the good without paying for it, leading to a free rider problem.

If too many individuals choose to behave as free riders and don't contribute to the provision of the public good, the cost of providing the good may become too high for those who are willing to pay for it, and the good may never be provided. This can lead to a situation where individuals are worse off overall because they are not able to benefit from the public good, even though they would be willing to pay for it.

Therefore, it is important for governments to intervene and provide public goods, such as infrastructure or national defense, to ensure that all individuals have access to the benefits of these goods, regardless of their ability or willingness to pay.

The correct option is c.

Learn more about the market economy:

brainly.com/question/2343400

#SPJ4

Answer:

the correct answer is the public good may never be provided

Explanation:

(econ1101)

what is the primary purpose of the legal system in an authoritarian state like russia, north korea, or china?
a. To serve god and equate lawbreaking with sin
b. To serve the rules and the state
c. To serve the citizens of that state
d. To ostracide nonconformits

Answers

The primary purpose of the legal system in an authoritarian state like Russia, North Korea, or China is: b. To serve the rulers and the state

In an authoritarian state like Russia, North Korea, or China, the primary purpose of the legal system is to serve the rulers and the state. This means that the legal system is designed to maintain the power and authority of the ruling class or political elite, rather than to protect the rights and freedoms of individual citizens.

The laws and legal processes are often used as a tool of control and repression, allowing the rulers to silence dissent, maintain social order, and consolidate their power. The legal system serves the interests of the state and the rulers, rather than the people.

Option b is the correct answer.

You can learn more about legal system at

https://brainly.com/question/10456202

#SPJ11

strategic information systems (siss) focus on big-picture, long-term goals and objectives and assist an organization or a decision maker to achieve them. true or false?

Answers

True. Strategic information systems (SIS) are information systems that are implemented to support and align with the goals and objectives of the organization. They are used to improve the efficiency and effectiveness of the organization and to give it a competitive advantage.

SIS focuses on planning, analysis, and decision-making activities to achieve long-term objectives. SIS tools can be used to assess the organization’s environment, such as market trends and competitor strategies. It can also help identify new opportunities and develop strategies to take advantage of them. SIS can also be used to track the implementation of strategic plans and measure their success. It allows the organization to be proactive and anticipate changes in the environment. Ultimately, SIS helps organizations to stay competitive and achieve their long-term goals.

Know more about  Strategic information systems here

https://brainly.com/question/17879676#
#SPJ11

unbalanced capacities that limit cost savings, difficulties in combining specializations, and reduced flexibility are disadvantages associated with strategic alliances. vertical integration. horizontal integration. divestiture.

Answers

Unbalanced capacities that limit cost savings, difficulties in combining specializations, and reduced flexibility are disadvantages associated with strategic alliances.

The option that best suits the given statement is strategic alliances.

What are Strategic Alliances?

Strategic Alliances refer to the voluntary agreement of two or more companies to collaborate and share their resources to achieve a common objective. It is a formal relationship between two or more companies, wherein they share their resources, technology, and expertise to achieve a specific objective.

In such alliances, each company remains independent and maintains its identity, but they work together to achieve a common goal. Strategic alliances may help in cost-saving and increasing profitability.

However, there are some disadvantages associated with strategic alliances. The disadvantages include the following:

Unbalanced capacities that limit cost savingsDifficulties in combining specializationsReduced flexibilityCoordination problemsDifferent corporate culturesPotential conflict of interestLack of trust and commitment between companies.

to know more about Strategic Alliances refer here:

https://brainly.com/question/14014533#

#SPJ11

the common stock of sweet treats is selling for $45.10 per share. the company is expected to have an annual dividend increase of 2.5 percent indefinitely and pay a dividend of $3.25 in one year. what is the total return on this stock?

Answers

The total return on a stock is the combination of any capital gains and dividends received. In this case, the stock of Sweet Treats is currently selling for $45.10 per share and is expected to pay an annual dividend increase of 2.5 percent and a dividend of $3.25 in one year.

The total return on this stock is calculated by first determining the dividend yield, which is the annual dividend divided by the share price. In this case, the dividend yield would be 7.2 percent ($3.25/$45.10). Next, the total return would be the dividend yield plus the expected dividend increase of 2.5 percent, giving a total return of 9.7 percent.

The total return is an important metric to consider when investing in stocks because it provides an indication of how much an investor can expect to receive over the holding period. It is important to note that the total return is not a guarantee of performance, as stock prices and dividends can fluctuate over time.

Know more about capital gains here

https://brainly.com/question/24084696#

#SPJ11

discuss how the importance of skills vary or may not vary deppending on where the leader is in the management structure

Answers

The importance of skills varies depending on the level of the skill management structure.

For top-level managers, strategic thinking and decision-making skills are crucial. These managers set the overall direction of the organization, establish goals and objectives, and make decisions that will affect the entire organization. Therefore, they must be able to think strategically, analyze complex information, and make sound decisions based on that analysis.

Middle-level managers need both technical and interpersonal skills. They must have a deep understanding of the technical aspects of their department or function and be able to use that knowledge to manage their teams effectively. They also need strong communication and leadership skills to motivate and inspire their teams to achieve their goals.

Front-line managers, who are often responsible for managing day-to-day operations, require strong technical skills to oversee the work of their teams. They need to understand the processes, procedures, and equipment used in their area of responsibility. They also need good communication and leadership skills to ensure that their teams are working efficiently and effectively.

However, it is important to note that all managers, regardless of their level in the management structure, require some degree of all these skills.

To know more about skill management, visit: brainly.com/question/30061269

#SPJ4

hope is desperate for the new designer purse that she saw while window shopping at her local mall. she knew every girl in school would covet her bag and wish to be like her. when she walked in, she whipped out her credit card, and purchased the $5,000 bag. this kind of purchasing is called: group of answer choices

Answers

The type of purchasing that Hope engaged in is called impulsive buying.

Impulsive buying refers to making unplanned purchases on the spur of the moment, usually without considering the consequences or thinking about the actual need for the item being purchased.

In Hope's case, she saw the designer purse and immediately wanted it because she believed it would make her popular and envied by others, rather than because she needed it or had planned to purchase it.

Impulsive buying can be driven by a variety of factors, including emotions, social pressure, or a desire for instant gratification. People who engage in impulsive buying may experience feelings of guilt or regret after making a purchase, especially if the purchase was expensive or unnecessary.

The complete question is:
What is the term used to describe the type of purchasing that Hope engaged in when she used her credit card to buy a $5,000 designer purse because she believed it would make her popular and envied by others?

To know more about impulse buying, refer here:

https://brainly.com/question/19427648

#SPJ11

35 Small-volume purchases or commodities that don't deserve a lot of time are considered what kind of buy? Bottleneck Critical □ Routine Leverage

Answers

Routine purchases are those made in little quantities or for items that don't require much thought.

Regular purchases are those that are made on a regular basis, have a low volume and frequency, and don't take a lot of time, effort, or money to make. These are frequently inexpensive things like office supplies, cleaning materials, or spare parts that are required to support continuing operations or maintenance. Regular purchases are frequently standardised and readily accessible from a variety of sources, making them easier to acquire and manage. For routine purchases, organisations frequently have set policies and controls in place, such as pre-approved vendor lists, computerised buying processes, or bulk purchasing agreements. Organizations may lower costs, increase efficiency, and free up resources for more critical tasks by streamlining their everyday purchasing procedures.

Learn more about "routine buys" here:

https://brainly.com/question/30950133

#SPJ4

apanda land company paid its first annual dividend yesterday in the amount of $.15 per share. the company plans to double the dividend in each of the next 3 years. starting in year 4, the firm plans to pay $1.50 per share indefinitely. what is one share of this stock worth today if the market rate of return on similar securities is 13.8 percent?

Answers

To calculate the value of one share of the stocks today, we can use the dividend discount model (DDM). The value of one share of this stock today would be approximately -$0.35.

Stocks, also known as shares or equities, represent ownership in a company. When you purchase stocks, you are essentially buying a portion of ownership in that company. Stocks are traded on stock exchanges, such as the New York Stock Exchange (NYSE) or Nasdaq, where investors can buy and sell shares.

Investing in stocks carries risks, as the value of stocks can fluctuate based on various factors, including market conditions, company performance, and economic trends.

Learn more about stocks here:

https://brainly.com/question/24239991

#SPJ12

the responsibility for the things we do or fail to do, with the possibility of being sued by another person is called

Answers

The responsibility for the things we do or fail to do, with the possibility of being sued by another person is called "legal liability".

Legal liability is the legal responsibility of an individual or entity to pay damages or compensation when they cause injury or harm to another person or their property. In most cases, legal liability arises when a person or entity fails to act in a manner that meets the standards expected by law.

For example, a person may be liable for negligence if they do not take reasonable care in the exercise of their legal duties or if they cause harm to another person through their negligent actions. In other cases, a person may be held liable for their intentional misconduct, such as causing harm through assault or battery. In addition, businesses and employers may be held liable for the wrongful acts of their employees.

In order to determine whether a person or entity is legally liable for a certain action, the courts will often consider several factors such as the nature of the act, the relationship between the parties involved, and any defenses that are available. Additionally, the courts will also look at whether the person or entity owed a duty of care to the other party and if the person or entity breached that duty.

Legal liability can also arise in contractual relationships when one party fails to fulfill their obligations as specified in the contract. In some cases, liability for breach of contract is imposed by law and not necessarily by the parties involved. Additionally, some forms of liability may arise in tort law, such as when a person commits the tort of negligence.

Overall, legal liability is the responsibility of an individual or entity to pay damages or compensation when they cause injury or harm to another person or their property. It is important to understand the concept of legal liability in order to protect oneself from being sued by another person.

To learn more about legal liability here:

https://brainly.com/question/28580181#

#SPJ11

using the allowance method, bad debt expense is recorded _____.

Answers

Using the allowance method, bad debt expense is recorded as an estimate in the period of the related sales.

How is bad debt recorded

Using the allowance method, bad debt expense is recorded by estimating the amount of uncollectible accounts receivable and recording it as an expense in the same accounting period in which the revenue was earned.

This is done by creating an allowance for doubtful accounts, which is a contra asset account that reduces the accounts receivable balance on the balance sheet.

Read more on bad debt here:https://brainly.com/question/24871617

#SPJ1

The three sources for online channels are Paid media. Owned media, and Earned media. True or False

Answers

The statement that "The three sources for online channels are Paid media, Owned media, and Earned media." is true.

Each media type represents a different method of promoting products or services, with its distinct characteristics and advantages. These three channels complement one another, enabling businesses to create a cohesive, multichannel digital marketing plan.

The following are explanations for each source of online channels:

Paid media: Advertisements or sponsored content that a business pays for to gain exposure, typically via digital advertising networks, social media advertising, or search engine advertising

Owned media: Online marketing assets that a business owns, including a company's website, blog, email newsletters, and social media channels

Earned media: Customer or audience-generated brand recognition and promotion through word-of-mouth, reviews, or social media shares, which is regarded as earned media because it is earned through excellent service or marketing efforts. Therefore, the statement is true.

To know more about online media : https://brainly.com/question/30157284

#SPJ11

simpson, age 45, is a single individual who is employed full time by duff corporation. this year simpson reports agi of $51,000 and has incurred the following medical expenses: dentist charges$ 1,680 physician charges2,310 optical charges720 cost of eyeglasses640 hospital charges3,000 prescription drugs365 over-the-counter drugs705 medical insurance premiums (not through an exchange)975 a. calculate the amount of medical expenses that will be included with simpson's itemized deductions after any applicable limitations.

Answers

Simpson is eligible to itemize deductions for medical expenses that exceed the standard deduction. The total medical expenses that Simpson incurred this year are $9,050.

To calculate the amount of medical expenses that will be included with Simpson’s itemized deductions, the following limitations must be applied:

1. First, only the medical expenses that are in excess of 7.5% of Simpson’s Adjusted Gross Income (AGI) of $51,000 are eligible for deduction. In this case, that would be $3,825 (7.5% of $51,000).

2. Second, if Simpson is eligible to receive reimbursement for any of his medical expenses from an insurance plan, then that amount is subtracted from the total medical expenses. This would include any premiums paid by Simpson through an exchange.

Therefore, Simpson is eligible to deduct $5,225 (total medical expenses of $9,050 minus the standard deduction of $3,825 and the insurance reimbursement of $975).

In conclusion, Simpson can include $5,225 in his itemized deductions for medical expenses. This is calculated by subtracting the standard deduction of 7.5% of AGI ($3,825) and any insurance reimbursements ($975) from the total medical expenses of $9,050.

To know more about standard deduction here

https://brainly.com/question/3158031

#SPJ11

which type of aggregate production plan is likely to have the least negative impact on the local community and the workforce?

Answers

The type of aggregate production plan that is likely to have the least negative impact on the local community and the workforce is one that implements sustainable and responsible production practices.

This type of plan involves utilizing practices that promote environmental conservation, conserve natural resources, minimize waste, and reduce air and water pollution. Additionally, it should prioritize local labor and promote equitable wages and benefits for employees.

To ensure a positive impact, an aggregate production plan should include measures such as:

1. Minimizing dust and noise pollution by using modern and efficient extraction and processing techniques.
2. Conserving natural resources by using renewable energy sources and water-efficient technologies.
3. Ensuring workers’ safety and well-being through proper training and enforcement of health and safety standards.
4. Establishing reasonable work hours and providing competitive wages and benefits to employees.
5. Addressing any potential health risks posed by the operations by conducting regular health risk assessments.
6. Conducting regular inspections of the production site to ensure compliance with local regulations.
7. Engaging with the local community to ensure that any negative impacts are minimized.

By following these steps, an aggregate production plan can be designed to minimize negative impacts on the local community and the workforce.

To learn more about aggregate production here:

https://brainly.com/question/30465601#

#SPJ11

internal markets, which are markets that managers set up within their organization, are: group of answer choices allowed to sell only to customers on an approved list of buyers. based on predetermined prices rather than equilibrium prices. set up to allocate resources of a company more efficiently, often not using real money. required to use real money to allocate real resources across firms in an industry.

Answers

Internal markets, which are markets that managers set up within their organization, are based on predetermined prices rather than equilibrium prices. The correct answer is B.

Internal markets refer to the internal mechanisms utilized by organizations to allocate resources more efficiently. Internal markets are markets that managers establish within their organization. They use these markets to exchange products, information, and services internally.They are based on predetermined prices rather than equilibrium prices. Companies might create internal markets as an alternative to purchasing resources externally. These markets might exist to allocate resources across departments or to account for employee effort within an organization. Thus, it is the second option in the question.The internal market is a system that has been set up within the organization to promote better and efficient utilization of resources, coordinate and plan the activities of different departments within the organization, and improve their performance.There are different types of internal markets, depending on the organizational structure, management approach, and objectives of the organization. The purpose of internal markets can differ depending on the company, but they are usually set up to allocate resources of a company more efficiently.Therefore, the correct answer is option "b. based on predetermined prices rather than equilibrium prices."

Learn more about  markets here: https://brainly.com/question/25754149

#SPJ11

Perform an analysis of the problem facing the oceanview development corporation, and prepare a report that summarizes your findings and recommendations. include the following items in your report: 1. a decision tree that shows the logical sequence of the decision problem 2. a recommendation regarding what oceanview should do if the market research information is not available 3. a decision strategy that oceanview should follow if the market research is conducted 4. a recommendation as to whether oceanview should employ the market research firm, along with the value of the information provided by the market research firm include the details of your analysis as an appendix to your report.

Answers

The problem analysis of the situation at Oceanview development corporation is given as follows.

What is the Problem Analysis of Oceanview?

Analysis:

Oceanview Development Corporation is facing a decision problem related to the development of a beachfront property. The company is uncertain whether to construct a hotel or a condominium. The decision tree shows that if the market research information is not available, the company should proceed with the construction of the hotel. However, if the market research is conducted, the company should choose between the two options based on the market research results.

Recommendations:

If the market research information is not available, the company should proceed with the construction of the hotel. This option has a higher expected value than the condominium.

If the market research is conducted, the company should follow the decision strategy that maximizes its expected value. Based on the market research results, the company should choose the option that has the highest expected value.

Oceanview should employ the market research firm, as the value of the information provided by the firm can be significant in making the decision. The market research can provide valuable insights into the market demand, pricing, and other factors that can influence the expected value of the options.

Appendix:

The analysis considers the expected values of the hotel and condominium options based on different scenarios of the demand and pricing. The decision tree shows that the hotel option has a higher expected value if the market research information is not available. However, if the market research is conducted, the expected values of the options depend on the market conditions. The analysis considers different scenarios of the demand and pricing to estimate the expected values of the options. The recommendations are based on the expected values and the decision strategy that maximizes the expected value. The market research firm can provide valuable information to reduce the uncertainty and improve the decision.

Learn more about problem Analysis  at:

https://brainly.com/question/28312524

#SPJ1

what are the primary business benefits of an erp system? group of answer choices a. sales forecasts, sales strategies, and marketing campaigns b. market demand, resource and capacity constraints, and real-time scheduling c. forecasting, planning, purchasing, material management, warehousing, inventory, and distribution d. sales system

Answers

An ERP system's main advantage is that it substitutes all of the datasets that were previously broken down into divisions like bookkeeping, wages, and commodities management.

A type of software known as enterprise resource planning (ERP) is used by organisations to handle routine business processes like accounting, purchasing, project management, risk management and compliance, and supply chain management.
An ERP system's main advantage is that it substitutes all of the datasets that were previously broken down into divisions like bookkeeping, wages, and commodities management. Using a single common database, it ultimately gives your organisation a clear line of sight across all divisions.
Forecasting, budgeting, buying, material management, warehousing, inventory management, and delivery are some of the main business advantages of an ERP system.
To know more about ERP system go through:-

https://brainly.com/question/14635097

#SPJ4

Consider a $100,000 30-year. 5.4% mortgage with monthly payments. What portion of the payments during the first 25 months goes toward principal? O 22.41% O 20.17% O 22.78% O 21.25% O 20.98%

Answers

The portion of the monthly payments during the first 25 months that goes toward the principal for a $100,000, 30-year, 5.4% mortgage is 20.98%.

The portion of monthly payments can refer to the amount of money that goes towards different components of the payment. This can vary depending on the type of payment being made, but here are some common examples:

Mortgage payments: For a mortgage payment, the portion of the monthly payment can be broken down into principal, interest, taxes, and insurance (often abbreviated as PITI). The principal is the amount of money going towards paying off the loan, while the interest is the cost of borrowing the money. Taxes and insurance are additional expenses that may be rolled into the monthly payment.Car payments: Similar to a mortgage payment, a car payment can be broken down into principal and interest. The principal is the amount of money going towards paying off the car loan, while the interest is the cost of borrowing the money.

Learn more about Portion of monthly payments : brainly.com/question/29489526

#SPJ11

if a bank has a capital to asset ratio of 0.1 and a return on equity of 10%, what is its return on assets?

Answers

If a bank has a capital to asset ratio of 0.1 and a return on equity of 10%, its return on assets will be 1%.

Return on assets (ROA) = Net Income / Total Assets. The capital to asset ratio is the total capital to total assets ratio, and it represents the amount of leverage used by a bank. A lower capital-to-asset ratio is desirable since it allows for a greater amount of asset investments. A return on equity (ROE) is the amount of net income generated by a business, divided by its shareholder equity.

ROE provides a measure of a company's profitability based on its shareholder's capital contribution. Return on equity (ROE) = Net Income / Shareholders Equity. We can calculate the return on assets (ROA).

ROE = Net Income / Shareholders Equity

10% = Net Income / Shareholders Equity (Equation 1)

ROA = Net Income / Total Assets

We need to calculate Net Income and Total Assets: Total Assets = Shareholders Equity / Capital to Asset Ratio

= Shareholders Equity / 0.1 (Equation 2)

Net Income = ROE * Shareholders Equity= 0.1 * Shareholders Equity (from Equation 1)

We can replace Net Income and Total Assets in (Equation 3)

ROA = Net Income / Total Assets= 0.1 * Shareholders Equity / Shareholders Equity / 0.1= 0.1 / 0.1= 1%

To know more about return on assets, refer here:

https://brainly.com/question/31080458#

#SPJ11

in the textbook, the expression quality at the source means that we need to purchase the best quality a supplier or vendor can provide.T/F

Answers

False. The expression "quality at the source" refers to the principle that quality should be built into a product or service from the beginning of the production process, rather than relying on inspection or correction after the fact.

This means that each person responsible for a particular aspect of the production process is responsible for ensuring that the quality of their work meets the required standards. This includes suppliers and vendors, who are expected to provide high-quality inputs that meet the required specifications. Therefore, "quality at the source" is not just about purchasing the best quality from suppliers, but also about ensuring that the production process is designed to produce high-quality outputs from the start.

Learn more about "quality at the source

https://brainly.com/question/29314706

#SPJ4

an antidrug policy which reduces the supply of heroin might: group of answer choices . reduce street crime because the addict's demand for heroin is highly inelastic. reduce street crime because the addict's demand for heroin is highly elastic. increase street crime because the addict's demand for heroin is highly inelastic. increase street crime because the addict's demand for heroin is highly elastic.

Answers

An antidrug policy which reduces the supply of heroin might increase street crime because the addict's demand for heroin is highly inelastic.

Inelastic demand means that changes in price or supply have little effect on the quantity demanded. In the case of heroin addiction, the demand for the drug is often very strong and not easily deterred by increases in price or decreases in supply. Therefore, reducing the supply of heroin may lead to an increase in crime as addicts may resort to illegal or violent means to obtain the drug.

Reducing the supply of heroin may also lead to a decrease in street crime if it causes some addicts to seek treatment and become drug-free. However, the immediate effect of reducing the supply of heroin is likely to be an increase in street crime.

To know more about antidrug policy, visit: brainly.com/question/10499567

#SPJ4

under the simplifying assumptions of modigliani and miller, an increase in a firm's financial leverage will a. *increase the variability in earnings per share. b. reduce the operating risk of the firm. c. increase the value of the firm. d. decrease the value of the firm.

Answers

In a perfect market with no taxes or bankruptcy costs, a rise in a firm's financial leverage will not have an impact on the value of the firm, according to Modigliani and Miller's simplifying assumptions (option c).

A company is an establishment that creates products or offers services with the intention of making a profit. There are many different types of businesses, including corporations, partnerships, limited liability companies, and sole proprietorships. The traditional organisational structure of businesses is hierarchical, with top-level executives in charge of making strategic choices while lower-level staff handle day-to-day operations. Businesses compete for clients in a market, thus they must often be able to add value for those customers, control expenses, and set themselves apart from rivals. Businesses must act morally and responsibly towards all of its stakeholders, including the general public, employees, clients, and suppliers.

Learn more about firm's here:

https://brainly.com/question/27852403

#SPJ4

an investor owns a portfolio of large capitalization blue chip stocks, each of which happens to be in the dow jones industrial average. he wishes to protect his portfolio from a market downturn without selling the positions. the best recommendation is to buy a:

Answers

The optimum response is (C), which is to purchase an index put, especially the DJX option that tracks the Dow Jones Industrial Average. The DJX is diverse since, while having just 30 equities, there come from a variety of industries. A narrow-based index choice might be industry or nation specialized.

In the money A word used in option trading to denote an option with intrinsic worth. In particular, an option is "in-the-money" whenever the connection in between underlying ministry's market price.

And also the option's strike of the choice reaches the point where executing should result in a gain towards the owner (buyer), ignoring any payments made. Whenever the underlying stock's current value exceeds the valuation of both the call.

To know more about stock's click here

brainly.com/question/21602828

#SPJ4

true or false: strategic trade policy does not advocate for government intervention in international trade.

Answers

The statement "strategic trade policy does not advocate for government intervention in international trade" is false  because  to increase a country's competitive advantage.  

This can be done through tariffs, subsidies, export and import quotas, and foreign direct investment. These interventions are often aimed at creating jobs, promoting local industry, and making the nation competitive in the global market.

For example, the US imposed tariffs on imported steel in 2018 to protect domestic steel production, which increased employment in the steel industry and made the US more competitive in the global market. In short, strategic trade policy does advocate for government intervention in international trade.

To know more about strategic trade policy, refer here:

https://brainly.com/question/28231747#

#SPJ11

To encourage exporting, a country might seek to maintain a low international exchange rate. How might they do this?
A: By maintaining the gold standard
B: By using a flexible exchange rate
C: By using a fixed exchange rate
D: By using a floating exchange rate
E: By employing PPP

Answers

Answer: c

Explanation:

To encourage exporting, a country might seek to maintain a low international exchange rate. They might do this by using a fixed exchange rate (Option C).

What do you understand by  fixed exchange rate ?

A fixed exchange rate system involves the government or central bank of a country setting and maintaining a specific exchange rate for its currency relative to another currency or a basket of currencies.

This can be achieved by using various monetary policy tools, such as buying or selling foreign currency reserves, adjusting interest rates, and intervening in foreign exchange markets.

By maintaining a low exchange rate, the country's exports become more competitive and attractive to foreign buyers, thus promoting exports.

To know more about fixed exchange rate  visit:

https://brainly.com/question/14160520

#SPJ11

the rate of return of a stock held for one year equals question content area bottom part 1 a. the dividend yield plus the rate of capital gain. b. the rate of capital gain minus the dividend yield. c. the dividend yield minus the rate of capital gain. d. the change in the price of the stock.

Answers

The rate of return of a stock held for one year is equal to the change in the price of the stock. The correct answer is D.

This means that the rate of return is equal to the difference between the closing price of the stock at the end of the one year period, and the opening price of the stock at the beginning of the one year period. If the closing price of the stock is higher than the opening price, then the rate of return will be positive; if the closing price is lower than the opening price, then the rate of return will be negative. This does not include any dividend payments made during the year, so it does not include the dividend yield.

In conclusion, the rate of return of a stock held for one year is equal to the change in the price of the stock, and does not include the dividend yield or the rate of capital gain.

For such more questions on stock

https://brainly.com/question/1193187

#SPJ11

what is the term that refers to the relationshp between benefits and the sacrifrice necesasay to obtain those beneifts

Answers

The term that refers to the relationship between benefits and the sacrifices necessary to obtain those benefits is cost-benefit analysis.

Cost-benefit analysis is a method used to compare the cost of a decision or action against the expected benefits in order to determine whether the investment is worthwhile. In order to complete a cost-benefit analysis, the decision-maker needs to first identify and quantify all relevant costs and benefits and then determine the time frame for each of them. Finally, the costs and benefits are compared, either in absolute terms or in terms of a benefit-cost ratio.

In order for the analysis to be accurate, it is important to consider all possible costs and benefits, even those that are difficult to quantify. These might include the costs and benefits of a decision to an individual or a group, such as health, safety, quality of life, and environmental impacts. The analysis should also take into account the value of money over time, such as through inflation or the opportunity cost of not investing the money elsewhere.

Cost-benefit analysis is a valuable tool for decision-makers as it helps them to determine whether the benefits of a particular action outweigh the costs associated with it. By considering all relevant costs and benefits, a decision-maker can make an informed decision and maximize the value of their investments.

For more such question on cost-benefit analysis

https://brainly.com/question/30578719

#SPJ11

the dollar cost of making x chargers is 100 40x-0.000025x^3. what is the marginal cost of the 200th charger?

Answers

The marginal cost of the 200th charger is $38.50. This means that if the company produces one additional charger beyond the 199th, it will cost $38.50 more to produce.

To find the marginal cost of the 200th charger, we need to take the derivative of the cost function with respect to the number of chargers produced (x) and evaluate it at x = 200.

The cost function is given as:

C(x) = 100 + 40x - 0.000025x^3

Taking the derivative of C(x) with respect to x, we get:

C'(x) = 40 - 0.000075x^2

Evaluating this expression at x = 200, we get:

C'(200) = 40 - 0.000075(200)^2

= 40 - 1.5

= 38.5

Learn more about marginal cost at: https://brainly.com/question/17230008

#SPJ11

Other Questions
the unadjusted trial balance columns of a company's work sheet shows the store supplies account with a balance of $580. the adjustments columns shows a credit of $325 for supplies used during the period. the amount shown as store supplies in the balance sheet columns of the work sheet is: What is an angle that is adjacent to DHC? which of the following is an internal control procedure used to safeguard a company's assets? multiple choice all of these answer choices are correct segregation of duties depositing cash receipts in a bank on a timely basis preparing a bank reconciliation what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use?