are pastrys are the best in town

Answers

Answer 1

mark this as brianlists okay

Answer 2

Answer:

OUR PASTRIES ARE THE BEST IN TOWN

brainliest??


Related Questions

Can knowing that other people feel the same or have had similar experiences help adolescents get through difficult times? How?

Answers

Answer:

Yes, realizing that other people have gone through similar and traumatic experiences as they have could make them feel less alone in the world, I would know that itd comfort me that I wouldn't be going through things alone.

Explanation:

What kind of irony is shown when Philip Malloy ask ms Narwin for extra help, nothing but the truth WILL GIVE Brainiest

Answers

Answer:

you will join brainly for answer if correct then that is your answer

I. Pick out the words whose underlined part is pronounced differently from the rest.A. played B. crowded C. helped D. returned

Answers

Explanation:

b, crowded

jsjskekdmdmlfldlslspd

ALL ABOUT ME!

Name
Nickname
Age
who are you thankful for ?
my favorite foods
when is your bday
my hobbies

Answers

Answer:

You

Explanation:

Those things are about you. You talk about yourself, you describe yourself, you list stuff about yourself. Other people can't answer that for you.

Help, do You help me whit an english job? I'm from spain​

Answers

Answer:

Sometimes I Have a shower after school

Dogs are usually friendly

Chris never watches TV in the morning

Martin hardly ever finishes his homework

Nicole is always on the phone

Now do ctrl + c and ctrl + v

I sometimes have to shower after school
Dogs are usually friendly
Chris never watches tv in the morning
Martin hardly ever finish his how work
Nicole is always on the Phone.



Mark me as most Brainly

who can help me please ​

Answers

Answer:

Stewardship, in this sense, is to ensure the well-being and perpetuation of God's established structures. By maintaining a way of life that is conducive to the optimal performance of earth's systems, men and women can faithfully steward creation and preserve its resources for future generations to enjoy

Explanation:

12. Why should you never leave a cooker unoccupied if on?​

Answers

Answer:

to avoid fire outbreak and it is flammanle

diary entry about the last day of school​

Answers

Answer:

Say what you can remember. If you can't remember anything, just make it up. For example, you could say that you are sad  about not seeing your friends,  Bam. There you go.

example

format of diary entry:

Monday,22 August, 2017

Dear diary

Content: for example : Today was my last day in my school. I was very happy to see and enjoy my last day. I was upset to leave my school but I was also happy to start my new journey of life which was life after graduation. I was hoping well wishes for everyone. I really enjoyed my day in my school.

ash lemon.

Note: diary is always written in past.

Help!!!!!!! 100 points!!! Summarize and Find the topic and main idea and use this format:
“Topic: ____
Main idea: ____

The text __”(title)”__ is about _(topic)_ and main _(main idea)_ (Continue with _important- information * in the order that it appears in the text.)

Answers

Answer:

Your main idea would be definitely on latitude and longitude. So I might phrase it as "Latitude and longitude have enabled navigators to accurately describe and locate where places are."

You can obviously change some of the word choice though

How are a migrant workers travels form of escape in the story?

Mice and men

Answers

Answer:

Of Mice and Men, written by John Steinbeck, is a story about two migrant

workers, George Milton and Lennie Small. They travel around with each

other, during the Depression, looking for work. In the first chapter,

George and Lennie are portrayed like tramps, who wander the streets

looking for a place to live and work.

in the hobbit The ponies die when


they run over a cliff


they are eaten by goblins


they are attacked with swords

Answers

Ponies die when eaten by goblins.

We can arrive at this answer because:

Bilbo is on an expedition with the dwarves when they decide to rest in the Great Goblin's cave.While sleeping, Bilbo dreams that he has a crack in the cave.He wakes up startled and realizes that the crack is real and that the Goblins can enter through it.One of these goblins ends up entering and devouring the ponies.

This story can be found in chapter 4 of "The Hobbit."

More information about "The Hobbit" at the link:

https://brainly.com/question/7563297

Who has read the book Night???

Answers

Answer:

Night is narrated by Eliezer, a Jewish teenager who, when the memoir begins, lives in his hometown of Sighet, in Hungarian Transylvania. Eliezer studies the Torah (the first five books of the Old Testament) and the Cabbala (a doctrine of Jewish mysticism). His instruction is cut short, however, when his teacher, Moishe the Beadle, is deported. In a few months, Moishe returns, telling a horrifying tale: the Gestapo (the German secret police force) took charge of his train, led everyone into the woods, and systematically butchered them. Nobody believes Moishe, who is taken for a lunatic.

In the spring of 1944, the Nazis occupy Hungary. Not long afterward, a series of increasingly repressive measures are passed, and the Jews of Eliezer’s town are forced into small ghettos within Sighet. Soon they are herded onto cattle cars, and a nightmarish journey ensues. After days and nights crammed into the car, exhausted and near starvation, the passengers arrive at Birkenau, the gateway to Auschwitz.

Explanation:

Write a brief summary plz ​

30 points !

Answers

Answer:

Too Lazy But Can Help You To Make It Easier

Explanation:

Cut Any Unnecessary Words Change The Meaning Of Some Words With Easier Words And Thats Pretty Much It

“On the whole” is this type of transition:

Answers

What do you mean by that?

what do you do if the spelling and grammar checker finds an error that is not really an error?

Answers

Answer:

You can ignore it  and keep writing or double check it to see if it is catching something you aren't. If you want to ignore it there might be an ignore button if you click on the word, and if you press it it just leaves it as is.

Explanation:

oh no! everyone has a nasty cold around you! write a silly poem about how you try to avoid catching their germs!

Answers

Answer:

la la la la

la la la la

la la la la

sorry bro I don't know how to write even a silly poem. Actually I cannot even understand the question because I am not good at English

1
1
In Chapter 12, Odilia calls on the goddess Tonantzin to help her and her sisters escape the nagual. Reread
page 187, beginning where Odilia awakens her sisters (Juanita, Velia, Delia, I called to my sisters...") until the
end of the chapter. How does each Odilia respond during their attempts to escape? What aspect of her
character does this reveal? Record your thinking in the chart below.

Answers

Answer:

Helps he sisters escape ?

Explanation:

why Is a pandemic a society changing event a long term? (3 reasons)​

Answers

Answer:

percussions

Explanation:

Carlos saw the first installment of his favorite movie series when he was in fourth
has watched each new film in the series on the night it opened in his local theate
liked the movies' fast-paced action and special effects. When the scheduled rele
installment was announced, Carlos marked his calendar and planned to see the
night. But when he and his dad tried to purchase tickets online, every show was
Which sentence provides an objective summary of the paragraph?
O A. Carlos is a movie enthusiast who wants to buy tickets for the latest install
action movie series.
O
B. Carlos follows an action movie series for years and plans to see the final
opening night, but it sells out before he can buy tickets.
O C. Carlos enjoys going to the theater to see action movies, but he is disapp
no tickets available for his favorite film.
O D. Carlos has been a dedicated fan of a series of action movies ever since
and plans to go to the theater to watch the finale.

Answers

Answer:

B

Explanation:

This summary includes his following the series for years and the tickets selling out before he can get them. This summary includes the two most important facts.

the first answer doesn't say anything about the tickets selling out, which is one of the most important facts.

C doesn't say anything about him following the series for years, which is an important fact to include.

D doesn't say anything about going to get tickets and them being sold out. That is an important fact to include.

Hope this helps!

the use of perfect tenses of the verb is important because _____​

Answers

Answer:

Perfect verb forms also apply to past and future tenses, where an event took place before another or will be completed in the future before another action.

Explanation:

Communicating events with indiscrete times can be tricky in English. The present perfect tense is supposed to make this easier. If you want to explain an event that happened at an indefinite time in the past or that began in the past and continues into the present.

Which word best describes the relationship between Bilbo and the dwarves?

Answers

Answer: Bilbo looks to the West and thinks fondly of his home. The dwarves suggest that he try to enter the Kingdom under the Mountain through the Main Gate; Bilbo turns down this suggestion immediately, since he’d likely to run into Smaug, and the dwarves reluctantly accept his decision.

Explanation:

Write email about journey you had

Answers

Answer:

i went to Kansas city with my family to this amusement park called worlds of fun and i had a blast

Explanation:

there you go hope it helps

In which sentence are the commas
placed correctly?
A. We went toward the shore got in a creek, landed
near a fence and there we remained till daylight.
B. I asked for biscuits, a loaf of bread, and cinnamon
rolls when I went to the bakery.
C. I certainly did seem to have a, most awkward,
ridiculous, and foolish appearance.

Answers

Answer:B

Explanation:used to show the sequence

Jesus Christ Symbolism in The Old Man and The Sea.

Answers

Answer:

The Old Man and the Sea is full of Christian imagery. Over the course of his struggles at sea, Santiago emerges as a Christ figure. ... More importantly, Santiago resembles Christ in that, like Christ, he transforms loss into triumph, faces the inevitability of death without complaint and, in doing so, transcends it.

Explanation:

Brainliest?

please help I'll give brainliest. Solve this what to write in the blank.
___ rainbow is beautiful
(A) A
(B) An
(C) The​

Answers

The rainbow is beautiful
Answer: (C) The

How to write narrative essays

Answers

Narrative Essay Format

A typical 5 paragraph narrative essay has one introduction, three paraghraphs in the main body, and one conclusion paragraph. If needed, you can change the number of body paragraphs according to the topic. It usually has these five elements: plot, characters, setting, conflict, and theme.

I hope it helps you..‍♀️

first you start with a title, then an introduction, start the beginning of the story, middle, end of the story, conclusion

Do all of these elements work together to achieve the desired response from the reader? Why or why not? Are there spots where​

Answers

Answer:

your questions are not complete what elements are you talking about.

Explanation:

1.Is there enough room ___________ in the car ? *
5 điểm
A. for me
B. for I
C. to I
D. to me

Answers

The answer is A. good luck!

14 POINTS TO SOMEONE WHOS GOOD AT ENGLISH ILL GIVE BRIANLY TOO

Answers

Answer:

Seems right.

Explanation:

It just does.

Matthew decided he was in over his head and quit which type of figurative language is the phrase "in over his head"

A) an idiom

B) metonymy

C) hyperbole

D) understatement

Answers

The answer is an idiom
Other Questions
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. A die with 8 sides is rolled. What is the probability of rolling a number less than 3 8) Lisa and Jasmine are selling cheesecakes for a school fundraiser. Customers can buy pecancheesecakes and apple cheesecakes. Lisa sold 3 pecan cheesecakes and 7 apple cheesecakes for atotal of $130. Jasmine sold 12 pecan cheesecakes and 14 apple cheesecakes for a total of $338.Find the cost each of one pecan cheesecake and one apple cheesecake. 2. Which country began studies on bioterrorist weapons in the 1930s? Whatwas the program known as? How did other countries respond to this?3. Why is plague attractive as a bioterrorism weapon?4. How did the English use smallpox during the French and Indian War?5. Which country loaded botulism toxins into bombs? Why is botulism of lessconcern than anthrax or plague?6. What animal is tularemia most associated with? How can humans becomeinfected? In what ways might it be transferred to humans as a bioterrorismweapon?7. Why do you think countries or groups might use these diseases asbioterrorist weapons? What advantages would they have over other types why did some people turn toward democratic forms of government during this time i need help to pass math What was at the center of the Greek house?A. The family roomB. The kitchenC. The andronD. The courtyard Which quadrant point (0,2) is located in the coordinate plane