A single bacterial cell typically contains between 2 and 4 nanograms (10-9 grams) of DNA. The correct answer is b.
Approximately a few picograms (10-9 grams) of DNA is present in a single bacterial cell. Bacterial cells are prokaryotic cells that reproduce by asexual reproduction or binary fission. Bacterial cells are among the most complex cells in the world. Bacteria do not have any intracellular organelles or membranes, and their DNA is located in the cytoplasm rather than a nucleus.
DNA content in bacteria ranges from less than 1 femtogram to more than 20 picograms. In a bacterial cell, the DNA concentration is frequently 1000 times greater than in mammalian cells. Since a bacterial cell has a smaller genome than a human cell, this indicates that the DNA is more tightly compressed.
The DNA is twisted into a helical structure and packed into an area called the nucleoid. Despite the fact that bacteria lack a nucleus, their DNA is still arranged in a compact, organized manner. The DNA is wound around histone-like proteins that function as architectural supports, similar to the way human DNA is packaged around histones in the nucleus.
The DNA in bacteria is much more compact than the DNA in human cells, allowing it to fit into a smaller space.
Learn more about bacterial cell here:
brainly.com/question/2145627
#SPJ11
a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left.true or false
The statement "a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left" is False.
A decision tree is read from left to right, but the conditions are usually represented as nodes or circles, and the actions or outcomes are represented as branches or lines. The conditions are evaluated at each node, and based on the outcome of that evaluation, the tree branches off to the next node, and so on until an action or outcome is reached.
The branches are typically labeled with probabilities or expected values, and the goal of the decision tree is to identify the optimal decision or course of action based on the available information and the desired outcome.
To learn more about decision tree refer to:
brainly.com/question/30673588
#SPJ4
1. The steps of the carbon cycle are described below.
Place the steps in the correct order.
a. Animals and plants release carbon dioxide and
water as a result of cellular respiration.
b. Carbon dioxide is released by plants and animals
and moves into the biosphere.
c. Plants use water and carbon dioxide from the
atmosphere to make sugar and oxygen through
the process of photosynthesis.
d. Animals and plants use sugar and oxygen for the
process of cellular respiration.
e. Cellular respiration transforms sugar and oxygen
into carbon dioxide and water.
Answer:
1. Plants use water and carbon dioxide from the atmosphere to make glucose and oxygen through photosynthesis.
2. Animals and plants use glucose and oxygen for cellular respiration
3. Cellular respiration transforms glucose and oxygen into carbon dioxide and water.
4. Animals and plants release carbon dioxide and water as a result of cellular respiration.
5. Carbon Dioxide is released by plants and animals and moves in the biosphere
Explanation: CO2 + H2O with energy (sun) = C6 H12 O6 + O2
discuss why it is important which of the two dna strands serves as a template during transcription.
What happens after glycolysis but before citric acid cycle?
a bacterial species differs from a species of eukaryotic organisms in that a bacterial species group of answer choices does not breed with other species. breeds with its own species. can be distinguished from other bacterial species. is a population of cells with similar characteristics. has a limited geographical distribution.
"A bacterial species differs from a species of eukaryotic organisms in that a bacterial species does not breed with other species."
A bacterial species does not interbreed with other species, but will only breed with its own species. This is different from a species of eukaryotic organisms, which may be able to breed with other species. Additionally, bacterial species can be distinguished from other bacterial species based on characteristics such as morphology, genetic makeup, and metabolic characteristics. Bacterial species also typically have a limited geographical distribution.
Learn more about bacterial species: https://brainly.com/question/8695285
#SPJ11
observe your frog heart after it has been removed. did it continue to beat? how? what else did you learn from your frog? anatomy? physiology? did you do any further tests? please elaborate. g
Yes, the frog heart continued to beat after it had been removed. This is due to the intrinsic excitability of the myocardium, or muscle tissue in the heart. This intrinsic excitability means that the heart can continue to beat without any external input from the nervous system.
From observing the frog heart, we can learn about anatomy and physiology. Anatomy refers to the structure and physical form of the heart. We can see the size and shape of the heart and the blood vessels entering and leaving it. Physiology is the function and processes of the heart. We can observe how the heart beats and pumps blood.
Further tests could include a detailed analysis of the heart rate. This could involve measuring the heart rate over time, looking for any changes in rate, or measuring the heart rate under various conditions. Additionally, one could measure the electrical activity of the heart by using an electrocardiogram. This would involve placing electrodes on the heart and measuring the electrical impulses.
In conclusion, by observing the frog heart we can learn about both anatomy and physiology and also explore other tests to gain a deeper understanding of the heart’s function.
For more such questions on Frog heart.
https://brainly.com/question/11126450#
#SPJ11
Need help asap please :(
Answer:
picture quality is low
Explanation:
write your question
Question 6
Skeletal muscles work with bones to give your body:
Strength
The ability to move
Strength and the ability to move
O None of the above
which atomic particles are in a unique cloud outside of the nucleus of the atom?
The nucleus of an atom is surrounded by a cloud of electrons. Remember, electrons are negatively-charged and are attracted to the positively-charged protons in the nucleus.
The fundamental unit of matter is thought to be the atom. Atoms are the building blocks of all objects with mass, or those that take up space. We now know that each atom is often made up of smaller particles, despite the fact that its original term referred to a particle that couldn't be further divided—the tiniest thing that was possible. They are frequently called subatomic particles because they are the building blocks of atoms. Three subatomic particles exist: protons, neutrons, and electrons.
Protons and electrons are the two subatomic particles with electrical charges. Protons have a positive charge, while electrons have a negative charge. In contrast, neutrons lack a charge. A basic tenet of physics is that charged particles repel one another while charged particles attract one another. Protons and electrons are therefore drawn to one another, much like the poles of a magnet. Protons are attracted to other protons and electrons are attracted to other electrons, much like when you try to push the same ends of two magnets together and encounter resistance.
To know more about electrons click here:
https://brainly.com/question/1255220
#SPJ4
the body compartments that participate in the immune system, after the formation of immune cells, are the . multiple select question. extracellular fluid mononuclear phagocyte system ciliary escalator bloodstream gastrointestinal lumen bone marrow cerebrospinal fluid lymphatic system
The body compartments that participate in the immune system, after the formation of immune cells, are the lymphatic system, extracellular fluid, mononuclear phagocyte system, and bloodstream.
What is the specific role of the immune system?The specific role of the immune system refers to the finish with pathogenic agents such as microorganisms or viruses, which depend on the presence of specialized cells and organs.
Therefore, with this data, we can see that the specific role of the immune system is to fight against bacteria and viruses to maintain a health state.
Learn more about the immune system here:
https://brainly.com/question/15595309
#SPJ1
What is transport in humans and plants and what is the difference?
Answer:
In humans the transport system occurs through vein, artery and capillaries. Whereas, in plants , it occurs through the xylem vessels, tracheids and phloem sieve tubes.
Explanation:
what are the two ways the video mentions that invasive species can be introduced into aquatic ecosystems? a) on ship hulls and in large aquariums b) on ship hulls and through hitchhikers c) in ballast water found in ships and through fish farm nets d) in ballast water found in ships and as bait in commercial fishing expeditions please select the best answer from the choices provided a b c d
Invasive species can be introduced into aquatic ecosystems through a variety of pathways, but the video mentions two specific ways.
The first way is through ballast water found in ships, which is water taken on board to stabilize the vessel during travel. When the ship reaches its destination, this ballast water is discharged along with any organisms it may contain, including potential invasive species. This is a common pathway for the introduction of aquatic invasive species.
The second way is through the use of live bait in commercial fishing expeditions. Live bait can contain non-native species that can be introduced into new environments if they are not properly disposed of. This pathway is often overlooked but can be an important source of invasive species in aquatic ecosystems.
Therefore, the correct answer is d) in ballast water found in ships and as bait in commercial fishing expeditions.
To learn more about aquatic ecosystems visit;
https://brainly.com/question/4967501
#SPJ4
two proteins interact to form a multimeric complex. when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. this type of mutation is classified as .
When one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.
What is a loss-of-function mutation?A loss-of-function mutation is a type of genetic mutation in which a gene's normal function is impaired or eliminated. This type of mutation can lead to a decrease or complete loss of protein function in the body. It might result in the inability to produce a protein or the production of a defective protein, both of which can have consequences for normal biological function. The severity of loss-of-function mutations can differ, depending on the importance of the protein and the extent of the mutation.
To sum up, when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.
Learn more about mutation: https://brainly.com/question/14438201
#SPJ11
the sequence of amino acids determines the __ protien which determines the protiens__
Answer:
The sequence of amino acids determines the primary structure of a protein, which determines the protein's higher-order structure, function, and properties.
The primary structure is the linear sequence of amino acids in a protein, which is stabilized by peptide bonds. The specific sequence of amino acids determines the protein's overall shape and how it interacts with other molecules.
The higher-order structure of a protein includes its secondary, tertiary, and quaternary structures, which are determined by various interactions between amino acids such as hydrogen bonds, disulfide bonds, and hydrophobic interactions.
The protein's function and properties are determined by its structure, and this can include enzymatic activity, transport of molecules, signaling, and structural support. Therefore, the sequence of amino acids is critical to the overall function and properties of a protein.
The amino acid sequence of a polypeptide chain defines the protein's ultimate 3D shape. Protein structure is classified into four levels: primary structure, secondary structure, tertiary structure, and quaternary structure. Furthermore, there are two types of 3D protein structures: spherical proteins and filamentous proteins. The information contained in the cellular genetic code determines the amino acid structure of a protein. The sequence of amino acids in a polypeptide chain is distinctive to each protein. A single amino acid change produces a DNA mutation, which usually results in a non-functioning protein. The "R" group changes between amino acids and dictates how these protein monomers vary. The information contained in the cellular genetic code determines the amino acid structure of a protein. The pattern of nucleotide bases in nucleic acids (DNA and RNA) that codes for amino acids is known as the genetic code. Proteins are made up of molecules called amino acids. A protein is composed of one or more straight strings of amino acids, each of which is referred to as a polypeptide. There are several types of amino acids that are frequently present in proteins.
the term for a specific molecule on which an enzyme acts is the
The term for a specific molecule on which an enzyme act is a substrate. Substrates are molecules that enzymes bind to and catalyze reactions on.
Enzymes are organic catalysts that are produced by living organisms. Enzymes are biocatalysts that speed up the rate of biochemical reactions within the cell, they are biologically active and necessary for the survival of the organism. A substrate is a particular molecule that binds to an enzyme's active site and is transformed by a reaction. The enzyme-substrate interaction is determined by the precise shape of the active site, as well as the shape and charge distribution of the substrate.
Learn more about substrate: https://brainly.com/question/4047091
#SPJ11
A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True or False?
A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True
A component with a lower flavor threshold means that it can be detected at lower concentrations, and therefore, can make a bigger contribution to the overall flavor profile of the beer.
For example, compounds like isoamyl acetate, which gives banana-like flavor, and diacetyl, which gives a buttery flavor, have low flavor thresholds and can be perceived even at low concentrations. Therefore, a small amount of these compounds can have a noticeable impact on the taste and aroma of the beer.
Learn more about lower flavor
https://brainly.com/question/17515899
#SPJ4
if a cell with 4 chromosomes undergoes mitosis how many daughter cells are made and how many chromosomes will each daughter have
If a cell with 4 chromosomes undergoes mitosis, 2 daughter cells are made and each daughter cell will have 4 chromosomes. Hence, if a cell with 4 chromosomes undergoes mitosis, 2 daughter cells are made and each daughter cell will have 4 chromosomes.
What is Mitosis?
Mitosis is a biological method that results in the replication of cells. This means that, as a result of mitosis, the number of cells in an organism increases. The whole process happens in four different phases: prophase, metaphase, anaphase, and telophase.
Cell division is a crucial aspect of human growth, and it is controlled by genes within the cell. It is important for the survival and growth of living organisms. It ensures that the genetic material in each cell is divided equally and that the daughter cells inherit the same genetic material as the parent cell.
Mitosis is a part of the cell cycle, in which a single parent cell divides into two daughter cells with identical genetic information. Each daughter cell produced during mitosis is identical to the parent cell in terms of its DNA content, meaning that the two daughter cells will each have the same number of chromosomes as the parent cell.
To learn more about chromosomes here:
https://brainly.com/question/30993611
#SPJ11
What is the significance of the crossing over that occurs between Nonsister chromatids during meiosis?
The significance of crossing over is the creation of new combinations of genetic material in offspring.
Crossing over occurs during meiosis when non-sister chromatids exchange segments of DNA. As a result, the offspring inherit a unique combination of genetic information from their parents. Crossing over promotes genetic diversity by creating new combinations of alleles that can contribute to the survival of populations under changing environments.
It also helps to explain why siblings may look different from each other, even when they have the same parents. Furthermore, crossing over can help to prevent the accumulation of harmful mutations by shuffling genetic material in a way that allows natural selection to act more effectively.
To learn more about Crossing over, here
https://brainly.com/question/19671756
#SPJ4
Why are the ddNTPs fluorescently labeled?
Which type of valve opens in response to increasing pressure in the ventricles?
The type of valve opens in response to increasing pressure is semilunar valves.
Semilunar valve, one of two pocket-like, half-moon-shaped organs that connect the heart's left and right ventricles to the aorta (aortic valve) and pulmonary artery, respectively. The semilunar valves allows blood to flow into the arteries from the ventricles and prohibit the backward flow of blood from the arteries into the ventricles.
The endocardium, a thin, smooth membrane, and connective tissue make up the semilunar valves. The atrioventricular valves, which are situated halfway between the atrium and the ventricle, cooperate with them in order to function. The audible pulse is connected to the closure of the heart valves. The atrioventricular valves close first, followed by the pulmonary and aortic semilunar valves, which produce the second sound.
Learn more about Semilunar valves:
https://brainly.com/question/14481540
#SPJ4
a black haired true breeding guinea pig is crossed with a white haired true breeding guinea pig. all of the offspring have black hair.
a. which color is dominant?
b. what are the genotypes and phenotypes of the parents?
c. what are the genotypes and phenotypes of the offspring?
a. Their phenotypes are black-haired and white-haired, respectively.
b. The genotype and phenotype of all offspring are BB and black-haired, respectively.
c. All of the offspring have black hair, so they must all have the genotype BB.
What are the genotypes and phenotypes of the parents?In this case, we can infer that black hair color is dominant over white hair color since all offspring have black hair.
Since they are both true breeding, their genotypes are homozygous dominant and homozygous recessive, respectively. Therefore, the genotypes of the parents are BB and bb. Their phenotypes are black-haired and white-haired, respectively.
Let's denote the black-haired true breeding guinea pig as BB and the white-haired true breeding guinea pig as bb.
Therefore, the genotype and phenotype of all offspring are BB and black-haired, respectively.
Learn more about genotype here: https://brainly.com/question/902712
#SPJ1
16. A farm has a bluish-gray color Andalusian fowl, but doesn't want anymore of that color of bird. Which color of bird
would be best for the farmer to breed the bluish-gray Andalusian fowl with in order to have the lowest chance of having offspring that are bluish-gray? Why?
Black (BB) and white (B'B') individuals are homozygous in Andalusian fowls. An homozygous white bird and a heterozygous black bird are crossed. All of the progeny are bluish grey.
What causes Blue Andalusian birds to exist?The Blue Andalusian fowl's plumage phenotype is the consequence of heterozygosity again for expanded black (E) gene combined with the blue (Bl) mutant (for a review, see Smyth, 1990). Heterozygotes' feathers have such a slate blue colouring as a result of the Bl gene's alteration of the normal synthesis of black pigment.
What kind of hens are Blue Andalusian?According to the Standard of Perfection, the Blue Andalusian should have white earlobes, smooth legs, or a single comb. Each feather should also be clearly interwoven with a dark blue or black. Male Section and click have an upright comb, whilst mature hens typically have a bigger comb which flops to one side.
To know more about heterozygous visit:
https://brainly.com/question/30622664
#SPJ1
Stomates are small openings on the leaves of plants. The following data was recorded for the stomates of a particular plant under various conditions of moisture in the air as measured by relative humidity.
Time Relative Humidity Stomates Condition
06:00 15% Closed
09:00 27% Closed
12:00 58% Open
15:00 82% Open
18:00 26% Closed
The data in the table could be used to support which explanation of a function of stomates? Stomates are responsible for–
A
preventing the loss of moisture from the plant to the environment.
B
regulating the flow of water from one cell to another in the plant.
C
ridding the plant of excess water vapor in dry conditions.
D
allowing the plant to absorb water from the soil after it rains.
a limiting the plant's ability to lose moisture to the environment.
Several plant species that thrive under the same circumstances in various settings have their roots measured.
This example demonstrates how negative feedback keeps homeostasis in check: a. where the face is subjected to friction, the epidermis thickens to produce a callus. The control of blood calcium levels is another illustration of negative feedback. The hormone parathyroid is secreted by the parathyroid glands, and it controls the amount of calcium in the body. The parathyroid glands detect a drop in calcium and release more parathyroid hormone as a result. Cell counting, pcv, cell fresh weight, and cell dry weight are methods for gauging growth in suspension culture.
Learn more about plant
https://brainly.com/question/31220793
#SPJ1
Which Leu codon can be converted to either Ser, Val, or Met by a single nucleotide substitution?
CUA
CUU
CUC
CUG
The Leu codons are CUA, CUU, CUC, and CUG. Of these, the CUA codon can be converted to either Ser, Val, or Met by a single nucleotide substitution.
Specifically, a CUA to UCA (Ser), CUA to GUA (Val), or CUA to AUG (Met) substitution would result in a different amino acid being incorporated into the protein sequence.
The other Leu codons (CUU, CUC, and CUG) have different nucleotide sequences and would require multiple nucleotide substitutions to be converted to Ser, Val, or Met codons.
The ability of the CUA codon to be converted to multiple different amino acids by a single nucleotide substitution is an example of genetic code degeneracy or redundancy.
This is because there are more codons (64) than there are amino acids (20), so some amino acids are coded for by multiple different codons. In the case of Leu.
To learn more about Leu codons here:
https://brainly.com/question/30367265
#SPJ11
mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply.
Mendel's understanding of the inheritance of traits in peas, expressed in modern language, include: The law of segregation, The law of independent assortment, The law of dominance
What is inheritance?
Inheritance refers to the passing of genetic material (traits) from one generation to the next. Inherited characteristics are determined by genes, and they can either be visible or not.
Mendel's discovery is the foundation of genetics as we know it today. This is because Mendel developed the first system for predicting inheritance, demonstrating that certain characteristics are transferred from one generation to the next.
To know more about inheritance of traits refer here:
https://brainly.com/question/22686199#
#SPJ11
There is evidence that the increasing carbon dioxide levels in the atmosphere are causing oceans to become more acidic. Ocean acidification may negatively impact species of phytoplankton, which are microscopic photosynthetic organisms that live in surface waters. Explain how the carbon cycle might be affected, if phytoplankton populations were to decrease.
Phytoplankton play a significant role in the carbon cycle. They are responsible for a large portion of the photosynthesis that takes place in the ocean, taking up carbon dioxide from the atmosphere and converting it into organic matter through photosynthesis.
If phytoplankton populations were to decrease due to ocean acidification, the amount of carbon dioxide that is absorbed from the atmosphere through photosynthesis would also decrease. This would result in an increase in atmospheric carbon dioxide levels, which would exacerbate the problem of global warming and climate change.
Furthermore, when phytoplankton die, they sink to the ocean floor, taking carbon with them. This is called the biological pump, which is an important mechanism for transferring carbon from the surface ocean to the deep ocean. If phytoplankton populations decrease, the biological pump would be weakened, leading to less carbon being transferred to the deep ocean. This would further exacerbate the problem of increasing atmospheric carbon dioxide levels, as less carbon would be removed from the atmosphere.
In summary, a decrease in phytoplankton populations due to ocean acidification could have significant effects on the carbon cycle, leading to increased atmospheric carbon dioxide levels and a weakening of the biological pump.
Different forms of the same element with different numbers of neutrons are called:
a. molecules
b. compounds
c. isotopes
d. lattices
Answer: c. isotopes
Explanation:
maybe sorry if wrong
Which of the parent cells can transmit the changed DNA to the offspring?
Through the process of cell division and reproduction, any parent cell that experiences a change in its DNA (genetic material) has the potential to pass the altered DNA to its offspring.
The egg cell (female gamete) and the sperm cell (male gamete) are the two parent cells in sexual reproduction, and they each provide the baby with half of its genetic makeup. An alteration in the DNA of either the egg or the sperm cell, such as a mutation, can be passed on to the progeny.
Asexual reproduction creates identical children by dividing the parent cell. Before dividing, if the parent cell goes through a DNA alteration, this DNA change will be present in both the parent cell and the child.
The type and magnitude of the DNA mutation, as well as other parameters including the progeny's viability and survival, all play a role in determining whether altered DNA is transmitted to offspring during sexual and asexual reproduction.
To know more about cell division,
https://brainly.com/question/29773280
#SPJ4
TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA
which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover
Crossover is the process based on DNA recombination.
The process of recombining the genetic material of two parents to create a new combination of genes is known as recombination. DNA recombination is a technique that enables cells to exchange genetic material, allowing for the exchange of genetic information. Homologous recombination, bacterial conjugation, and crossover all involve DNA recombination.
Homologous recombination is a DNA repair process that occurs in cells that have experienced DNA damage. It's a procedure that entails the transfer of genetic material from one DNA molecule to another. The procedure is most common in cells that have stopped dividing or have stopped dividing altogether.
Homologous recombination is a very effective mechanism for repairing DNA damage, and it is commonly used by cells to repair double-strand breaks. Bacterial conjugation is a process that allows bacteria to transfer genetic material, such as plasmids, from one bacterial cell to another. Bacteria use this mechanism to transmit genetic material between cells, allowing them to pass on beneficial traits like antibiotic resistance.
Crossover is a DNA recombination mechanism that occurs during meiosis. The chromosomes' maternal and paternal copies swap genetic information during this process, resulting in new combinations of genes in the offspring's cells. Crossover is responsible for the genetic diversity of the offspring and is a critical component of evolution.
Learn more about DNA: https://brainly.com/question/16099437
#SPJ11