Activity 5
Help help help
Please

Activity 5Help Help HelpPlease

Answers

Answer 1

Answer:

I think that the students had the courage to protest against segregation because of the adults around them or the peers they were around. I also think that they found the courage to protest against segregation because of how they saw that they needed to make a change.

Explanation:


Related Questions

Which of the following is equal to 88 ÷ 8?

Answers

Answer: 11

Explanation:

if you know your multiples of 8 you would know that 8 times 10 is 80 so if you add 8 to 80 that would give you 88. and always remember that division is backwards multiplication for example 4 times 2 =8 the 8 divided by 2 would equal 4.

8,16,24,32,40,48,56,64,72,80,88

or you can just count the numbers i don't know how to explain division better than that...

What time periods do you think would have the most trouble reading Othello?

Answers

Answer:

prabably from our evolutiion to 3,500 bc ish

Explanation:

this is an aproximation and you may get different answers depending on your sources

Read the passage from A Raisin in the Sun.

WALTER (as he dances with RUTH): You know, when these New Negroes have their convention— (Pointing at his sister.)—that is going to be the chairman of the Committee on Unending Agitation. (He goes on dancing, then stops.) Race, race, race! . . . Girl, I do believe you are the first person in the history of the entire human race to successfully brainwash yourself. (BENEATHA breaks up and he goes on dancing. He stops again, enjoying his tease.) D a m n, even the N double A C P takes a holiday sometimes! (BENEATHA and RUTH laugh. He dances with RUTH some more and starts to laugh and stops and pantomimes someone over an operating table.) I can just see that chick someday looking down at some poor cat on an operating table and before she starts to slice him, she says . . . (Pulling his sleeve back maliciously.) "By the way, what are your views on civil rights down there? . . .”

He laughs at her again and starts to dance happily. The bell sounds.

BENEATHA: Sticks and stones may break my bones but . . . words will never hurt me!

How does the playwright develop the theme in this passage?

Beneatha's reaction to Walter's teasing shows that family members are often crueler to one another than strangers are.
Beneatha's reaction to Walter's teasing shows that even family members who see the world differently can get along with one another.
Walter’s teasing of Beneatha shows that every family deals with severe tensions.
Walter’s teasing of Beneatha shows that one’s identity cannot be separated from race.

Answers

Answer:

Beneatha's reaction to Walter's teasing shows that even family members who see the world differently can get along with one another.

Explanation:

"A Raisin in the Sun" is a play made by Lorraine Hansberry in 1959. The story centers on the life of a black family who live in Chicago. Beneatha and Walter are both casts in the play. They are siblings who live with Walter's wife, Ruth, and their mother, Lena.

The situation above happened on a Saturday (the moving day). Ruth was talking to Beneatha and suddenly mentioned about how she went to watch a movie with Walter (which they rarely do these days). Walter then appeared and danced with Ruth, while Beneatha was teasing them. Although they do not get along well with some issues in the play. It can be portrayed that they, too, have good times.

For example, Beneatha would often mock his brother for having no money and for lacking in education. However, the situation above shows that even if Beneatha and Walter see the world differently, they can get along with one another.

Answer:

B) Beneatha's reaction to Walter's teasing shows that even family members who see the world differently can get along with one another.

Explanation:edge 2023

Why is it ironic, or contrary to what you might have expected, that Dorothy
considers the deed of manumission to be so precious in A Soldier for the Crown?

Answers

Answer:

The above question is from ‘A Soldier for the Crown’ in which the character Alexander Freeman was granted manumission. It is ironic that Freeman considers the deed of manumission to be so precious because she got the pass to be free from slavery under the name Alexander Freeman when in reality she is a woman.

‘A Soldier for the Crown’

Explanation:

True or false. These sentences have variety.

Jet skis are another way to travel. Jet skis are fun to use. Jet skis are fast.

True
False

Answers

This is true because I’m real life jet skis are really fast

One of the most poignant features of Animal Farm is the role of various animals as victims. Do you think they were willing victims? Explain.

Answers

Beginning with Mr. Jones abandoning the animals in subpar conditions, Animal Farm depicts them as neglected victims. This sparked a revolution, and the animals eventually gained their freedom and took control of the farm.

What is the concept of the excerpt?

Many animals became the unwitting victims of Napoleon and the other pigs as the events that followed the seizure of the farm played out. The pigs stole the eggs from the chickens who had been promised their offspring. The pigs stole the milk from the cows. The young pigs were treated unfairly and put to death for their resistance.

On the other hand, some creatures, like the horse Boxer and gullible the sheep, can be considered willing victims and devoted to the cause. Boxer worked as a slave for the animal kingdom without ever objecting. He had been given away.

Thus, Beginning with Mr. Jones abandoning the animals in subpar conditions.

For more information about concept of the excerpt, click here

https://brainly.com/question/21546581

#SPJ1

Select all that apply: What elements should be included in your conclusion?
Responses

Evidence

Call to action

Sources

Overview of reasons

Answers

1. sources
2. overview of reasons
Sources and Overview of reasons.

Glittering jewelry always catches my eye. If I am shopping and I spot a sparkling necklace

Answers

We can answer and complete the sentences with our knowledge of what present participle and past participle, which are verb forms, as seen below:

Sparkling is a present participle. Shopping functions as a verb, not as a present participle. In the passage, the word engraved is an example of a past participle.

Present participle vs. past participle

A present participle is a verb form that ends in "-ing," such as "walking," "eating," or "dancing." Present participles are often used to form progressive verb tenses, such as the present progressive ("I am walking") or the past progressive ("She was dancing").

A past participle is a verb form that usually ends in "-ed," such as "walked," "eaten," or "danced." Past participles are often used to form the passive voice or various verb tenses, such as the present perfect ("I have walked"), the past perfect ("She had danced"), or the passive voice ("The cake was eaten").

This is the complete question:

Use the passage to answer the questions. Glittering jewelry always catches my eye. If I am shopping and I spot a sparkling necklace, I check to see how much it costs. By saving my allowance, I can often buy new costume jewelry. Once I even found a beautiful engraved bracelet at a yard sale. I was thrilled! Read the passage. Then, use the drop-down menus to complete the sentences.

... is a present participle. ... functions as a verb, not as a present participle. In the passage, the word engraved is an example of a...

Learn more about present participle here:

https://brainly.com/question/1372579

#SPJ1

Make words from the word "flounders". No plurals. No one,two or three letter words

Answers

Answer: Flour, Enfold, Fleuron, Fondue, Fondle, Fondler, Found, and Drone.

Explanation: Thats all I could think of (I'm unsure how to answer this explanation).

Write a descriptive story with the title "lost in the city"​

Answers

Answer:

Explanation:

Joey was lost in the city. He had been walking around for hours, but he couldn't seem to find his way back to his hotel. Everywhere he looked, there were tall buildings, bustling streets, and crowds of people. He was overwhelmed and had no idea which way to go.

Joey stopped to take a deep breath, but the air was thick and smoggy. He felt a wave of panic rising up inside of him, and he had to fight the urge to turn around and run. He was so lost, so alone.

He took another deep breath and tried to remember what his hotel looked like, but he couldn't recall any details. He looked up at the sky, hoping to get his bearings, but the sun had already set and the sky was dark. He was completely disoriented.

He started walking again, unsure of where he was going. He passed by countless unfamiliar faces, hearing snippets of conversations in languages he couldn't understand. Everywhere he went, he was an outsider, an intruder in a strange and unfamiliar world.

He kept walking for what felt like hours, until he eventually stumbled upon a familiar landmark. He recognized the bridge, and with a sigh of relief, he knew he was close to his hotel. He followed the bridge until he finally arrived at his destination.

Joey was exhausted and relieved to finally be back in familiar territory. He had been lost in the city, but he found his way back. He felt a wave of gratitude wash over him as he opened the door to his hotel, relieved to be safe and sound.

Read the passage.

excerpt from "Why Equal Pay Is Worth Fighting For" by Senator Elizabeth Warren, April 17, 2014

I honestly can't believe that we're still arguing over equal pay in 2014.

When I started teaching elementary school after college, the public school district didn't hide the fact that it had two pay scales: one for men and one for women. Women have made incredible strides since then. But 40 years later, we're still debating equal pay for equal work.

Women today still earn only 77 cents for every dollar a man earns, and they're taking a hit in nearly every occupation. Bloomberg analyzed Census data and found that median earnings for women were lower than those for men in 264 of 265 major occupation categories. In 99.6 percent of occupations, men get paid more than women. That's not an accident; that's discrimination.

The effects of this discrimination are real, and they are long lasting. Today, more young women go to college than men, but unequal pay makes it harder for them to pay back student loans. Pay inequality also means a tougher retirement for women. . . .

For middle-class families today, it usually takes two incomes to get by, and many families depend as much on Mom's salary as they do on Dad's, if not more. Women are the main breadwinners, or joint breadwinners, in two-thirds of the families across the country, and pay discrimination makes it that much harder for these families to stay afloat.

Women are ready to fight back against pay discrimination, but it's not easy. Today, a woman can get fired for asking the guy across the hall how much money he makes. Here in the Senate, Sen. Barbara Mikulski (D-Md.) introduced the Paycheck Fairness Act to give women the tools to combat wage discrimination. It would help ensure that salary differences have something to do with the actual job that they are doing, and not just because they are women.

Question
Which statement most accurately describes Elizabeth Warren’s viewpoint about wage inequality?
Responses

It is a form of discrimination.
It is a form of discrimination.

It decreases as women gain work experience.
It decreases as women gain work experience.

It is most obvious in professional occupations.
It is most obvious in professional occupations.

It is an unpopular practice.

Answers

Answer:

It is form of discrimination

Kindly help:)
Read the following text, which is an ecotourism advertisement from The Dian Fossey Gorilla Fund International conservation website.
Analyse the text, focusing on form, structure and language. [25]

What to expect when you visit gorillas in Rwanda:

‘A life changing experience!’ This is what most tourists say after they visit the mountain
gorillas in Rwanda, and Fossey Fund staff totally agree, since they spend every single
day with gorillas — each day is exciting and new discoveries happen all the time.
Mountain gorillas are a unique species, with complex personalities and behaviors, as
well as interesting social structures. Our researchers take detailed notes about what
they see among the gorillas each day, just as Dian Fossey used to do. And now we
have a 50-year database of such information!
Here are some of the details about the wonderful experience of seeing the mountain
gorillas of Rwanda:

Getting ready to see the gorillas:

The walk that tourists take to get to the gorillas is an experience in itself, as it brings
you to one of the most beautiful places on earth. This is one of the few remaining tropical mountain forests, located on the steep slopes of the Virunga volcanoes. Gorilla groups are spread out everywhere among the five volcanic mountains (Karisimbi, Bisoke, Sabyinyo, Gahinga, Muhabura), so depending on which group you are going to visit your itinerary will differ. The walk to reach a gorilla group can take from one to several hours, but no matter how long it is, the end result is always amazing.

Expert gorilla trackers always lead the way, as they detect and follow gorilla traces from the last spot where the designated gorilla group was seen. These traces can include hand and foot prints, bent vegetation, remains of plants the gorillas have eaten and other signs. Every small detail is investigated, as the trackers determine the gorillas’ direction.

It’s not possible to predict how far the gorillas have moved from the previous day, or
what direction they’ve taken, so patience is definitely a good state of mind while following trackers at this time. But sooner or later, they will find the group they are seeking. There they are!

The first sight of gorillas is unforgettable! Inside the intense green of the dense
vegetation, you’ll see dark shapes as you go closer. It takes a few seconds to realize
that these shapes are wild gorillas, right there in front of you. Amazingly, they are
perfectly calm. The gorillas may glance at you at first, but will quickly resume their
normal activities.

You will be impressed by the huge size of the adult male gorillas (reaching up to 400
pounds). They are called silverbacks because of the gray color of the hair on the
backs. You will notice that the adult females are much smaller and do not have gray backs.

TIP 1: If you happen to look into the eyes of a gorilla, take a quick moment to fully enjoy
the experience, but then immediately take your gaze off the gorilla’s eyes and look
down. This signals to the gorilla that you are not a threat and that everyone can relax.
These gorillas are habituated to the presence of humans, which means that they tolerate us without modifying their behaviors, seeing us as a neutral part of their environment. However, in order to maintain this peaceful setting, there are rules for humans to follow.

TIP 2: Humans are asked to keep a safe distance of 7 meters (about 23 feet) away
from the gorillas. This also prevents spreading any human diseases to the gorillas. If
a gorilla moves closer to you, you stay still and let him pass by. If you happen to be
standing exactly where a gorilla wants to be, just give him the space and let him move
as he likes. If the gorilla approaches you and then sits down, you should slowly move
away to resume the 7-meter distance.

Spending time with mountain gorillas is truly one of the most memorable wildlife
experiences on earth. Being in and amongst a gorilla family is sure to create memories
and impressions that you will never forget. With only 880 mountain gorillas remaining,
it is also important for tourists to remember their own behavior when they are with the
gorillas, to minimize any potential risk to the gorillas. This means maintaining the required distance, coughing into your arm, and avoiding spitting or eating in the forest.

Answers

In the given case, the type of advertising mentioned in the text is narrative advertising.

What is advertising?

Advertising is referred to as a tool of marketing that is mainly used to educate customers and create awareness about a particular product or any modification or new features introduced in the existing product in order to make a purcahse.

In the given case, narrative advertising is used where the speaker provides narration about ecotourism and its experience by defining the narrative and every single detail from The Dian Fossey Gorilla Fund International conservation.

Learn more about Advertisement, here:

https://brainly.com/question/27937825

#SPJ1

I really need help! It says "Look at this diagram from into the unknown. Describe an important idea from the text that this visual helps you understand."
(I'll give you the diagram first)

Answers

Answer:

that could be trade. trade between two people or so

Which statement from the passage above best sums of the Rogers main argument, news about turkeys not turkey

Answers

There is one thing we can be passage sure of: He was not inclined to eat a roasted turkey or even to carve and give gratitude for it.

Being a vegetarian, why was Fred Rogers?

In one issue, he declared, "I love tofu burgers and beets," announcing his co-ownership of Vegetarian Times in the middle of the 1980s. According to him, he turned vegetarian for both moral and health reasons, as reported by Vegetarian Times.

Eat fish, Mr. Rogers?

Rogers quit consuming all meat, fish, and poultry in the beginning of the 1970s. Frances Moore Lappé wrote "Diet for a Small Planet," a persuasive essay in favor of vegetarianism, around that period.

To know more about passage visit :-

https://brainly.com/question/26999874

#SPJ1

What actually happens when Eleanor visits for the first time? What does Park say that upsets her? Why?

Answers

Eleanor in trouble with her mom and her stepfather, Richie, and she is forbidden to see Park (or any other boy).

Choose one connotation and explain how it EMPHASIZES the theme of the poem "The Road Not Taken"

Answers

One connotation in the poem "The Road Not Taken"  is the idea of regret.  This emphasizes the importance of making choices and recognizing that each choice has its own set of consequences.

The Road Not Taken" by Robert Frost

One connotation in the poem "The Road Not Taken" by Robert Frost is the idea of regret. The speaker describes how he took one road over another, knowing that he would likely never return to the first road again. The phrase "And sorry I could not travel both" (line 2) suggests that the speaker feels regret over not being able to take both paths and see where they lead.

This emphasis on regret reinforces the poem's theme of choices and their consequences. The speaker is forced to choose between two paths, each with its own set of unknowns and possibilities. The fact that he feels regret over not being able to take both paths shows that he recognizes the significance of this choice and the potential impact it will have on his life.

Furthermore, the line "I shall be telling this with a sigh" (line 16) suggests that the speaker will continue to feel this sense of regret and wonder about what could have been. This connotation of regret highlights the theme of the poem by emphasizing the importance of making choices and recognizing that each choice has its own set of consequences. By emphasizing the potential regret that can come from making a choice, the poem encourages readers to consider their own choices carefully and to think about the potential outcomes of each option.

Learn more on connotations here : https://brainly.com/question/16944543

#SPJ1

(this has to do with IXL) THANK YOU FOR YOUR PATIENTS DURING CONSTRUCTION correct the mistake in the sentence

Answers

change patients to patience.

Is the underlined word a
preposition or subordinating
conjunction?


Strauss died in 1902, four
years before an earthquake
and fire destroyed his
company's factories.


Underlined word:before

Answers

Explanation:

The underlined word "before" is a preposition.

“Before” is a preposition.

____ we cut trees and destroy natural habitat? stop!! before it is too late

(i) might
(ii) may
(iii) must
(iv) could ​

Answers

answer is could i believe

Answer:

ii) May

[tex]\purple{\underline{\sf{May}}}[/tex] we cut trees and destroy natural habitat? Stop!! before it is too late.

why is leadership important wish leadership important, Give some evidence, 4-5 sentences ​

Answers

Answer:

Leadership is important for many reasons. Firstly, it provides direction and guidance to a group of people or organization towards achieving a common goal. A good leader inspires and motivates people to work towards a shared vision, which enhances the efficiency and productivity of the team. Secondly, leadership creates a positive culture and work environment that fosters collaboration, open communication, and mutual respect. This helps to build trust among team members, resulting in increased creativity and innovation. Finally, effective leadership promotes accountability, responsibility, and ethical behavior, which is essential for achieving long-term success and sustainability. Overall, leadership is a critical factor in shaping the success of any group or organization.

Is the underlined section
an adjective or adverb
clause?

After the earthquake, the
company built a new
factory that is still
operating today.

Underlined section:that is still operating today.


AND



Is the underlined section a prepositional phrase or direct object


After the final exam, students are allowed to go to the library.


Underlined section:After the final exam

Answers

The underlined section "that is still operating today" is an adjective clause, as it modifies "factory." It provides additional information about the factory, specifying that it is still operating today.

What is the  adjective clause?

An adjective clause is a dependent clause that modifies a noun or pronoun in a sentence. In the sentence "After the earthquake, the company built a new factory that is still operating today," the adjective clause "that is still operating today" modifies the noun "factory."

Therefore, the underlined section "After the final exam" is a prepositional phrase, as it begins with the preposition "after" and functions as an adverb modifying the verb "are allowed." It provides information about when the permission to go to the library takes place.

Learn more about clause from

https://brainly.com/question/766213

#SPJ1


In the context of the article, how are we changed by war? How does conflict affect the Rohinyga refugees and the people with whom they interact? How has the conflict in Myanmar impacted Rohingya refugees' understanding of hope?

Answers

In the article How We are Changed by War by Diana C. Gill, it is correct to state that War and conflict have devastated Rohingya refugees, causing displacement, trauma, loss of identity, discrimination, and a loss of hope.

What is the rationale for the above response?

War and conflict have profound effects on individuals and communities. In the case of Rohingya refugees, the conflict in Myanmar has forced them to flee their homes, resulting in displacement, trauma, and a loss of their sense of identity and belonging.

Rohingya refugees often encounter hostility and discrimination in the countries they flee to, which exacerbates their feelings of marginalization and despair. Moreover, the lack of access to basic necessities such as food, shelter, and healthcare, worsens their physical and emotional well-being.

The conflict has also deeply impacted the Rohingya refugees' understanding of hope. Many have lost faith in the possibility of returning home or finding a new home, which has led to a sense of hopelessness and resignation. The ongoing conflict and persecution have left them with a pervasive sense of uncertainty and insecurity about their future.

Learn more about  how are we changed by war at:

https://brainly.com/question/30238020

#SPJ1

Which of the follow statements is true? Websites have page numbers so you must include them. can decide to use either the author's last name or the title of the work when cite a source. If the author isn't listed, then I should put "Anonymous" as the author. Use a comma between the author's last name and the page number Keep parenthetical citations short and to the point. No extra punctuation should be used

Answers

The true statement will be:

I can decide to use either the author’s last name or the title of the work when I cite a source.

If the author isn’t listed, then I should put “Anonymous” as the author.

How to convey the information

Websites do not usually have page numbers, so if you are citing a website, you may need to use other information, such as the author or date of publication, to create an in-text citation.

When citing a source, it is generally best to use the author's last name, but if the author is not listed, you may use the title of the work instead.

If the author of a source is unknown, it is not appropriate to simply put "Anonymous" as the author. Instead, you should use a shortened version of the title in place of the author's name.

When including a citation within parentheses, it is appropriate to use a comma between the author's last name and the page number, such as (Smith, 123).

Learn more about website in:

https://brainly.com/question/28431103

#SPJ1

According to the description of the crowded shores of Erebus in Hades: Lord of the Dead, how do the anonymous dead view the living? Responses As nothing at all As nothing at all As sad memories As sad memories As water creatures As water creatures As irresistible objects

Answers

In the given lines Personification figurative language has been used here as it is giving human characteristics to the non-human things such as sad.

What is figurative language?

The term Figurative language has been refers to the language that has makes the meaning to the reader or the listener to understand something through its relation to some other thing, action, or image.

Personification has the authorship of the human characteristics such as the emotions, behavior etc. to non-living objects.

Therefore, the figurative language include metaphors, similes, personification, hyperbole, and symbolism.

Learn more about the figurative language here:-

brainly.com/question/2569664

#SPJ9

HELP ME PLEASE, EASY ASSIGMENT WILL GIVE BRAINLYEST!!
Part 1: The Rough Draft (20 points)
Jellyfish are slowly “Damaging fishing operations”. They frequently poison and kill fish. There are also Consuming fish eggs and young small fish.
They are slowly damaging fishing and are “Discouraging tourism”. People all over Hawaii and Australia will be in danger because of these jellyfish. Worldwide jellyfish sting 150 million times per year. Most jellyfish aren't harmful but some of them like the box jellyfish are extremely dangerous.
Box jellyfish, which include some of the most dangerous organisms on the planet, frequently swarm in tropical oceans all over the world, including Hawaii and Australia. But, if we lower the amount of sewage dumped into the ocean then Lowering the sewage will decrease the food source for jellyfish and boost the population of fish that consume the goopy organisms!
So in conclusion, If we lower the amount of sewage the food source for jellyfish will decrease which will cause more fish population and less jellyfish, which will help people around the world.


Part 2: The Final Draft (40 points)
Revise your rough draft by making improvements to your syntax, spelling, capitalization, punctuation, and formal language and by incorporating feedback from your instructor. After making these edits and revisions, paste the final draft of your essay below. (40 points)


Part 3: Works Cited Page (20 points)
Paste your properly formatted Works Cited page below.



Part 4: Reflection (20 points)
Answer the following questions in complete sentences.
· What are three changes you made from your rough to your final draft?


· In which areas of your writing were you the most successful?


· After looking at the areas that needed revising in your rough and final drafts (syntax, spelling, capitalization, punctuation, and formal language), what were your biggest writing challenges?


· Based on your challenges, what goal will you set for your next essay?

Answers

Part 2: The Final Draft Jellyfish are causing harm to the fishing industry and its operations. In addition to poisoning and killing fish, they frequently consume fish eggs and young fish.

Additionally, jellyfish pose a threat to people and deter tourists from visiting places like Hawaii and Australia.

Part 3: Sources cited This essay did not use any sources at all.

Part 4: Reflection I made three changes between the first and final drafts:

By correcting spelling and grammatical errors, restructuring sentences for clarity, removing informal language, and adding a more formal tone, I believe I was most successful in improving the essay's overall clarity and coherence.

The most challenging aspects of my writing were formal language and syntax. Throughout the essay, I struggled with sentence structure and maintaining a formal tone.

What is contemplation?

Reflection is the process of looking at an experience, activity, or piece of work to get a better understanding or insight. Examining one's own writing process, identifying one's strengths and weaknesses, and contemplating ways to improve one's writing in the future are all aspects of reflection.

Reflection can include a variety of activities, such as reviewing notes or feedback, examining the writing itself, or conducting self-evaluation or self-criticism. The improvement of self-awareness and the identification of areas for growth and improvement are the goals of reflection. Reflection is a useful tool for writers of all levels because it allows them to continuously improve their skills and the quality of their work.

Learn more about essay writing:

brainly.com/question/11606608

#SPJ1

Activity 4:Matching
Pleaseeee help me in this question

Answers

Answer: Match the similar words

Explanation:

activist:fighter disagreement:controversy oppression=mistreatment spontaneous=unplanned  associate=join segregate=seperate

Imagine you are Lakshmi on your journey from Nepal to India. Write a brief scene or vignette,

describing what you see and how you feel along the way. Use a similar text structure and writing

style (e. G. Diction, tone, and sentence structure)

Answers

As I set out on my journey from Nepal to India, I am filled with a mixture of emotions - excitement, fear, and uncertainty. The path ahead is long and winding, and I know that the road will be filled with challenges and obstacles that I must overcome.

As I make my way through the Nepalese countryside, I am struck by the natural beauty that surrounds me. Rolling hills and verdant fields stretch out before me, and the air is filled with the sweet fragrance of wildflowers and fresh grass. The sun beats down on me, but I am undaunted, for I am driven by a sense of purpose and a burning desire to succeed.

As I cross the border into India, the landscape changes, and I am met with a cacophony of sounds and smells that assault my senses. The streets are crowded with people, all rushing to and fro, and the air is thick with the smell of spices and cooking food. But amidst the chaos, I see glimmers of hope and possibility, for the people here are filled with a vitality and energy that I have never experienced before.

As I journey deeper into India, I am filled with a sense of wonder and awe at the sights and sounds that I encounter. The architecture is breathtaking, with towering buildings and intricate temples that seem to touch the sky. The people are warm and welcoming, and I feel a sense of belonging that I have never felt before.

Despite the challenges that I face on my journey, I am filled with a sense of determination and resilience. I know that the road ahead will be difficult, but I am undeterred, for I am driven by a sense of purpose and a desire to make a better life for myself and my family. And as I journey on, I am filled with a sense of gratitude for the opportunity to explore this vast and beautiful country, and to experience the many wonders that it has to offer.

To know more about writing skills, visit the link given below:

https://brainly.com/question/19120658

#SPJ4

The maid broomed the house, is it correct grammar

Answers

Answer:

no

Explanation:

the maid swept the house

Answer:

no

Explanation:

The maid swept the house.

How does malala provoke,clam,and inspire her audience? Use Evidence and Explanation

Answers

Malala Yousafzai provokes, calms, and inspires her audience through her powerful speeches and actions. She provokes her audience by speaking out against injustice and inequality, particularly in relation to girls' education.

Which can challenge the status quo and make people uncomfortable. However, she also calms her audience by presenting a message of hope and peace, emphasizing the importance of education and unity to achieve positive change. Malala's personal experiences of surviving a brutal attack by the Taliban also inspire her audience by highlighting her resilience and courage in the face of adversity. By sharing her story and advocating for change, Malala inspires others to take action and make a positive impact in their own communities.

For such more question on Malala Yousafzai

https://brainly.com/question/11579451

#SPJ4

help plssssssssssssssssssssssssssss

Answers

Explanation:

In recent years, the use of automated vehicles has become more prevalent as technology continues to advance. Automated vehicles, also known as driverless vehicles, are cars that are capable of driving themselves without the need for human input. These vehicles are equipped with sensors, cameras, and other advanced technologies that allow them to navigate roads, avoid obstacles, and communicate with other vehicles on the road.

One reason why automated vehicles are becoming more common is that they offer several benefits over traditional human-driven vehicles. For one, they are more efficient and can operate without the need for human breaks, reducing the time it takes to transport goods or passengers. Additionally, they have the potential to reduce the number of accidents on the road as they are not subject to human error or distracted driving. Automated vehicles also have the potential to reduce traffic congestion, as they can communicate with each other to optimize the flow of traffic.

The role of technology in driverless vehicles cannot be overstated. Advanced technologies such as lidar, radar, and GPS are used to navigate the vehicle, detect obstacles, and identify other vehicles on the road. Machine learning algorithms are also used to improve the vehicle's ability to predict and respond to changes in the road environment. The development of these technologies has been made possible by the increasing availability of computing power, big data, and cloud computing. Additionally, the advent of 5G networks has enabled faster and more reliable communication between vehicles and the infrastructure around them.

While the benefits of automated vehicles are clear, some challenges must be overcome before they can become widespread. One of the biggest challenges is developing regulations and laws to govern their use. This includes determining liability in the event of an accident, setting standards for vehicle safety, and ensuring that the technology is secure from hacking or other malicious attacks. Additionally, there are concerns about job loss as the transportation industry becomes increasingly automated.

In conclusion, the increasing prevalence of automated vehicles is due in large part to the advancements in technology that have made them possible. These vehicles offer numerous benefits, including increased efficiency, reduced accidents, and improved traffic flow. While there are still challenges that must be addressed before they become widespread, the future of transportation looks increasingly automated.

Other Questions
Record yourself giving a performance of as much of "Chatter at a Royal Ball" as you cminutes if you need, and when you are ready, just click on the record button. You canREPLAY.*Note: This is a practice activity. Completing this activity will not only prepare you forimportantly, it will enhance your language ability. This activity will not count towards yo The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers?