A wide, fan shaped deposit sloping down. A geologist took this aerial photo of a location where a river flows out of a mountain range. What feature is pictured here? alluvial fan delta flood plain oxbow lake

Answers

Answer 1

Answer:

alluvial fan

Explanation:

correct on edge 2020

Answer 2

Answer:

Alluvial fan

Explanation:

I just took the assignment on edge!


Related Questions

At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?

Answers

Answer:

It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not

Explanation:

Need help with science.

Answers

Answer:

what exactly do you need help with? like whats the question?

Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water

Answers

Answer:

I think its water or sugar.

I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight

Answers

Answer:

D. Sunlight

Explanation:

Answer:

santa claus

Explanation:

What role do currents play in rivers and streams?

Answers

Answer: A current, in a river or stream, is the flow of water influenced by gravity as the water moves downhill to reduce its potential energy. The current varies spatially as well as temporally within the stream, dependent upon the flow volume of water, stream gradient, and channel geometry.

Explanation:

Answer:

Currents help the water in rivers and streams flow downhill, with the ultimate goal of flowing into the oceans, which are at sea level.

Explanation:

got me a 100 on edge 2020

Attempt to

A

A

1

2

3

4

5

6

7

8

9

10

»

A century ago, swords were made from various metals, especially steel. The property that makes steel a good choice for

sword making is

tensile strength

ductility

strength

conductivity

NEXT QUESTION

READ NEXT SECTION

ASK FOR HELP

TURN IT IN

Answers

Answer:

The property that makes steel a good choice for sword-making is strength

Explanation:

The strength of a material is its ability to withstand an applied load or force without failure or plastic deformation.  Types of strength of materials include; tensile strength, yield strength, torsional strength, compressional strength, shear strength.

Tensile strength of material is the ability of that material to withstand any force that tends to break or tear it apart. It is calculated by dividing the maximum amount of load or force the material can carry or withstand without breaking by the surface area of the material.

Mathematically, Tensile strength = Force/area

Its unit is Newton per meter squared, N/m².

Yield Strength In Steel

Yield strength is the maximum stress that can be applied before it begins to change shape permanently. Yield strength represents the upper limit of the load that can be safely applied to the meta beyond which it shape deforms.

Steel is an alloy of iron and carbon. It has many important and desirable properties such as durability, hardness and conductivity, and high tensile strength. However, the high strength of steel made a good choice for sword-making in the ancient past and even in the present.

the process of which cells make proteins is called protein what?

this is a fill in the blank!

Answers

Answer:

protein biosynthesis

Explanation:

prove me wrong

Answer:

any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.

Explanation:

Which statement is scientifically based
A Mutations rarely occur.
B All mutations are harmful.
C Some mutations can be contagious, like infections.
D Mutations are not passed from parent to offspring.

Answers

Answer:

Some mutations can be contagious, like infections

Explanation:

A mutation refers to a change in the DNA sequence. Mutations result from a number of causes. It is a permanent alteration in the structure of the DNA.

Not all mutations are harmful. It has been scientifically proven that some mutations make organisms more infectious.

For instance, the new mutant of Corona virus in UK is more infectious than the former strain.

Answer:

A. Mutations rarely occur.

Explanation:

EDGE 2021

In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.

B.
Phosphates are absorbed by the roots of plants.

C.
Animals eat the plants that absorbed the phosphates.

D.
Animals that ate the plants die and decompose.

Answers

Answer:

D

Explanation:

The physical characteristics of an organism are its

Answers

Answer:

appearance, development, and behavior

Explanation:

The phenotype, similar to the genotype, can be observed in two senses: wider and narrower. In a broader sense, a phenotype is a set of all morphological and physiological properties by which an organism is recognized and by which it differs from other organisms.

When we look at only one trait, then it is the narrower meaning of the phenotype. What will be the influence of genotype on phenotype depends not only on the genetic basis but also on the action of environmental factors in which the organism develops.

Many new reproductive strategies developed during the evolution of terrestrial vertebrates. Which statement identifies one of these new strategies? A. Eggs develop without fertilization B. Eggs develop outside of a parent's body C. Eggs are laid by the female parent only D. Fertilized eggs develop away from the body of water

Answers

Answer:

D

Explanation:

One of the reproductive strategies of terrestrial vertebrates is the ability of fertilized eggs to develop away from the body of water.

Water is very important for fertilization in aquatic organisms and one of the biggest challenges posed by migrating to the terrestrial environment is desiccation of the eggs. Terrestrial vertebrates are able to overcome these challenges by making fertilization of eggs internal and the ability of the fertilized eggs to develop away from the body of water.

The correct option is D.

Answer:

D. Fertilized eggs develop away from a body of water

Explanation:

when using a solar powered calculator what source of energy is being used to power the calculater

Answers

Answer:

UV rays

Explanation:

Solar energy and solar rays is what powers the calculator

Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh

Answers

Answer:

Behavior adaptation

Explanation:

Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe

plzzz help i willl give you a Brainliest if you get it correct

Most scientists come up with questions to investigate out of the blue.

1.true

2. false

Answers

The answer is False

Answer:

the correct answer is false.

What purpose does xylem serve in trees?
Giving brainliest to first correct answer

Answers

Answer:

i think the life soucre

Explanation:

Answer:Xylem is the plant vascular tissue that conveys water and dissolved minerals from the roots of the plant to the rest of the trees for physical support. Basically provides the tree with a way to stand.

Explanation:hope that answer helped I tried<3

Why is sickle cell anemia so harmful to its carriers?

Answers

Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK

Explanation:

Answer:

Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.

Sickle cell anemia puts your body at more risk for infection.

Explanation:

what are the two main organs involved in the respiratory system?​

Answers

Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.

Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.

What is the respiratory system?

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

nose and lungs i think

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment

Answers

Answer:

All of the above

Explanation:

Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.

Adaptations of plants in different climatic conditions in Telangana

Answers

Explanation:

Note, Telangana is known to be an area whose climate is usually semi-arid, that is, it is an area that is dry and receives some small amount of rain.

Thus, plants in the Telangana region would usually possess  the following adaptive features;

ability to survive under extreme heatgrowing longer roots than normal in other to find water in the soilefficient water conservation especially in their stems.

please help me Which example is a trace fossil?

dinosaur footprint


dinosaur bone


dinosaur egg


shark tooth

Answers

Dinosaur egg would be your answer.

Answer:

Dinasour footprint

Explanation:

6 grade science

Sulfur has 16 electrons in its atoms. Over how many energy levels are the electrons distributed, and how many are in each
energy level?

Answers

Sulfur has 16 electrons in its atoms. Over how many energy levels are the electrons distributed, and how many are in each energy level? The electrons in a sulfur atom are distributed over the three energy levels; there are two electrons in the first energy level, eight in the 2nd, and six in the third.

As DNA polymerase adds new nucleotides it's creating a new nucleic acid polymer. What kind of reaction is this enyme facilitating?

A. hydrolysis

B. dehydration

C. catalysis

D. exothermic

Answers

Answer:

C. Catalysis

Explanation:

The polymerase catalyzes the nucleophilic attack of the 3′ hydroxyl group terminus of the polynucleotide chain on the α-phosphate group of the nucleoside triphosphate to be added

1. Even though the atom is made of charged particles, it is still neutral Explain why. (1 point)

Answers

Answer:

An atom is electrically neutral (overall charge is zero) since the total number of protons is equal to the total number of electrons.

Hope this answered your question :)

What is the nervous system and how does it help you function? What structures are included in the human nervous system?

Answers

The nervous system is the major controlling, regulatory, and communicating system in the bodyThe nervous system plays a role in nearly every aspect of our health and well-being. It guides everyday activities such as waking up; automatic activities such as breathing; and complex processes such as thinking, reading, remembering, and feeling emotionsThe nervous system has two main parts: The central nervous system is made up of the brain and spinal cord. The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Does eukaryotic cells need more lipids than prokaryotic cells

Answers

Answer: yes because they need more energy

Explanation:eukaryotes are more complex than prokaryotes

This is a negative charge. On the left draw the type of charge that would move away from it. On the right, draw the
type of charge that would move towards it.
(This is science)

Answers

Answer:

On the left is negative charge while on the right is positive charge.

Explanation:

On the left, there should be negative charge that will move away due to repulsion force because both charges are same so they move away from one another while on the other hand, on the right side there should be positive charge which will move towards it because both charges are opposite to each other so they attract each other.

What is a niche, and how does it relate to evolution?

Answers

Answer:

The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes

Explanation:

ye

What is the value of the expression 3 divided by 3/4

Answers

Answer:

4

Explanation:

If we have the expression, 3/3/4.

Then this is the same as 3 × 4/3

Which is the same as 12/3

Which is the same as 4

Hence the value of the expression 3/3/4 is 4

Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:

Other Questions
Martin used 1/3 of his inheritance to pay off the mortgage on his house and 3/5 of what was left to purchase a new automobile. How much was left from his total $30,000 inheritance after these two expenditures El volumen es dependiente de la materia o independiente? Boiling tube containing calcium hydroxide what is the primary significance of the brown v board of education of tapioca supreme court dission of 1954 This is not a question about an assignment but what are some tips to getting work done faster and not getting so distracted. :) Apply the algebra tiles to find (8x2 + 8x + 5) - (2x2 + 6x + 4).A)6x2 + 2x - 1B)6x2 + 2x + 16x? + 14x + 1D)10x2 + 2x + 1 HURRY TODAY IS MY LAST DAYIn which two ways can citizens effectively improve the problems in their communities?by paying credit card bills on timeby speaking up when they disagree with government actionsby not paying their taxesby traveling to foreign countriesby sending petitions to their government representatives What should substance abuse treatment programs comply with the regulations governing release of patient information? Help please!!!!!!!!! ILL GIVE BRAINLIEST5 is 30% of what number HEY YOU! Yes, you, sitting behind your screen reading this. I don't know you and you certainly don't know me. But I want to tell you something. Everyone has their own story. Yours might be filled with joy and happiness, or it might be clouded with pain and misfortune. I want you to know that you're a beautiful, wonderful, talented person. Even if your life isn't going the way you want it to right now, I know that you'll be able to make it out alright. I want you to do me a favor. I know I'm just a stranger, but just trust me, okay? Every time you see your reflection, be it in the mirror in the bathroom, in a window somewhere, or in a puddle on the street, I want you to look at yourself and give yourself a hug. Because even if you aren't the prettiest or the smartest or the funniest, you're something that no one else can be: you. And you are the greatest thing you can be. Smile at strangers. Be confident in yourself. Cry when you feel like crying, laugh when you feel like laughing. Treat yourself like a god/goddess because you deserve it. Hold your head up and keep your heart open. You're worth everything and then some. And always remember that no matter what, even if it doesn't seem like it, you're everything to someone. I was bullied for so long and was told that I wasn't beautiful, and it broke me down. But I realized that I am beautiful and so is everyone else. I wanted to make sure no one felt upset like I did - hating myself and crying to sleep. You are all special The local school board wants to get parents to evaluate teachers. They select 100 parents and find that 89% approve of their childs teacher IssueAnti-Federalist belief in the need for a bill of rightsAdams administration's response to challengeWhen Congress passed the Alien and Sedition Acts, many people thought theyviolated the Bill of Rights. They saw the acts as a power grab by Federalists.Anti-Federalist belief in the importance of state sovereignty- Anti-Federalist fear that the president would have too much powerAnti-Federalist fear that a strong federal government would become corruptAnti-Federalist resistance to undue taxation Quick Help! Will mark brainliest!!! a-2=7 solve this question please Social participation is the backbone of socialization. Justify the statement. Which natural resource became more available to the American public as a result of railroad expansion? natural gas wood coal water 7. Slips are drawn form a box containing 100 slips written with numbers 1 to 100. If three slips aredrawn one after the another with replacement, then the probability that first slip bears an evennumber, second bears an odd number, third bears a perfect square number, isa)1/100b)1/25c)1/45d)1/40 The LGBTQ+ Movement is a Social Movement that's original goal was to attach systemic oppression of gay and lesbians. This goal has changed over time to be more inclusive of all types of people and attach all systemic oppression. true or false Please help me!!!!!! Steam Workshop Downloader