a. What are the possible solutions to keep public pension plans well-funded for current and future retirees with minimal disruption to participating members? Provide 3-4 recommendations and implementation plans.
b. What are expected impacts and consequences for each of your recommendations?

Answers

Answer 1

Possible solutions to keep public pension plans well-funded are increasing employee contributions, adjusting the retirement age, reducing benefits, and increasing employer contributions. These can lead to long-term sustainability of the pension plan.

A. To keep public pension plans well-funded for current and future retirees with minimal disruption to participating members, the following recommendations and implementation plans can be considered.

RecommendationsIncreasing employee contributions: One possible solution is to increase the contributions of employees to the pension plan. This can be implemented by gradually raising the contribution rate over a period of time to minimize the financial impact on employees.Adjusting the retirement age: Another possible solution is to adjust the retirement age to reflect longer life expectancies. This can be implemented by gradually increasing the retirement age over a period of time, giving current and future retirees time to plan and adjust their retirement plans accordingly.Reducing benefits: Another possible solution is to reduce the benefits provided by the pension plan. This can be implemented by gradually reducing the benefits over a period of time, giving current and future retirees time to plan and adjust their retirement plans accordingly.Increasing employer contributions: Another possible solution is to increase the contributions of employers to the pension plan. This can be implemented by gradually raising the contribution rate over a period of time to minimize the financial impact on employers.

B. The expected impacts and consequences for each of the recommendations are as follows.

ConsequencesIncreasing employee contributions: This recommendation may result in employees having less disposable income, which could impact their overall financial well-being. However, it could also help to ensure the long-term sustainability of the pension plan.Adjusting the retirement age: This recommendation may result in employees having to work longer before they can retire, which could impact their overall quality of life. However, it could also help to ensure the long-term sustainability of the pension plan.Reducing benefits: This recommendation may result in retirees receiving less income during retirement, which could impact their overall financial well-being. However, it could also help to ensure the long-term sustainability of the pension plan.Increasing employer contributions: This recommendation may result in employers having to allocate more funds towards employee retirement benefits, which could impact their overall financial well-being. However, it could also help to ensure the long-term sustainability of the pension plan.

Learn more about Pension plans:

https://brainly.com/question/28008155

#SPJ11


Related Questions

Problem 1. Cost function derivation (1 point) A firm has a production function q = 4K0.75L0.25, where q is the amount of output produced, K is the amount of capital while L is the amount oif labor invested in production. Total cost are: TC(KL) =rK + WL, where r = 3 is the price of a unit of capital while w = 16 is the price of a unit of labor. Minimize the total cost with respect to K and L using Lagrangian auxiliary function and express the minimized cost as a function of q.

Answers

Problem 1. Cost function derivation (1 point)

A firm has a production function q = 4K0.75L0.25, where q is the amount of output produced, K is the amount of capital while L is the amount of labor invested in production. Total cost are: TC(KL) =rK + WL, where r = 3 is the price of a unit of capital while w = 16 is the price of a unit of labor.

To minimize the total cost with respect to K and L, we need to use Lagrangian auxiliary function. We can write the Lagrangian auxiliary function as:
L = rK + WL - λ(4K0.75L0.25 - q).

To find the minimized cost, we can take the partial derivatives of the Lagrangian with respect to K and L and set them to zero. This gives us:

∂L/∂K = r - λ*3/4*K-0.25*L0.25 = 0

∂L/∂L = W - λ*1/4*K0.75*L-0.75 = 0

Using the production function, we can solve the first equation for K, and the second equation for L. This gives us:

K = (4*w/r)4/3*L4/3  

L = (4*r/w)3/4*K3/4

Plugging these values back into the cost function, we can solve for the minimized cost as a function of q as follows:

TC(q) = r*[(4*w/r)4/3*L4/3] + W*[(4*r/w)3/4*K3/4] = q*[r*(4*w/r)1/3 + W*(4*r/w)1/4]

Therefore, the minimized cost is TC(q) = q*[r*(4*w/r)1/3 + W*(4*r/w)1/4].

To know more about Cost function

https://brainly.com/question/29583181

#SPJ11

: Having just won a crossword puzzle contest, you may take your prize in any of three cash flow patterns. If money is worth 20% per year to you, which pattern would you most prefer? Which pattern would you least prefer? Pattern A B С $200 0 0 2 $200 0 0 YEARS 3 $200 $1,000 $400 4 $200 0 $400 5 $200 0 $400 How much money must be invested each year in a sinking fund earning 7% per annum in order to have $30,000 accumulated after 15 years?

Answers

The amount of money that must be invested in a sinking invest fund is $1,226.35 each year.

If money is worth 20% per year to you, the most preferred cash flow pattern would be Pattern C because it provides the highest amount of money in the shortest amount of time. Pattern C provides $400 each year for three years, for a total of $1,200.

This is more than Pattern A, which provides $200 each year for five years, for a total of $1,000, and Pattern B, which provides a one-time payment of $1,000.

The least preferred cash flow pattern would be Pattern A because it provides the lowest amount of money over the longest amount of time.

To determine how much money must be invested each year in a sinking fund earning 7% per annum in order to have $30,000 accumulated after 15 years, we can use the formula:

A = P * ( (1 + r) ^ n - 1) / r

Where A is the accumulated amount, P is the annual payment, r is the interest rate, and n is the number of years.

Rearranging the formula to solve for P, we get:

P = A * r / ((1 + r) ^ n - 1)

Plugging in the given values, we get:

P = 30,000 * 0.07 / ((1 + 0.07) ^ 15 - 1)

P = 1,226.35

Therefore, you must invest $1,226.35 each year in a sinking fund earning 7% per annum in order to have $30,000 accumulated after 15 years.

To know more about Invest fund refer here:

https://brainly.com/question/24278676#

#SPJ11

Explain how banks are able to reconcile conflicting requirementsof lenders and borrowers.

Answers

Banks are able to reconcile conflicting requirements of lenders and borrowers through the process of intermediation.

What Is Intermediation?

Intermediation involves the bank acting as a middleman between the lender and the borrower, matching the needs of each party and facilitating the transaction. The bank is able to do this by offering different types of loans and deposits, with varying terms and interest rates, that meet the needs of both lenders and borrowers. For example, a bank may offer a high-interest savings account to attract lenders, while also offering low-interest loans to attract borrowers. Through intermediation, banks are able to balance the conflicting requirements of lenders and borrowers and ensure that both parties are satisfied.

Learn more about bank reconciliation at https://brainly.com/question/15525383

#SPJ11

Given the number of deliberate threats to information systems of organizations, how effectively can they be dealt with? How can organizations protect their information systems against their biggest weak point: the human element?

Answers

The deliberate threats to information systems of organizations can be effectively dealt with by taking appropriate security measures.

These measures include maintaining strong authentication protocols, patching systems regularly, regularly backing up data, and training users on cyber security best practices.

Organizations can protect their information systems against the human element by ensuring that users are adequately trained on security protocols and regularly informed on the latest security threats.

Additionally, organizations should establish strict access policies, use two-factor authentication, and monitor user activity on the system.

To know more about cyber security click on below link:

https://brainly.com/question/24856293#

#SPJ11

Calculate the Present Value of the following mixed Streams assuming discount rate is 12%, Years 1 through 5 6 through 9 10 through 15 Cash Flows $6,000 per year $5,000 per year $8,000 per year Mr. Jeffrey has taken a loan from Natwest bank amounting $500,000 for 5 years to buy a luxury car. Annual interest rate for the loan is 14%. Prepare a "Loan Amortization Schedule" for 5 years assuming the installments are paid on annual basis.

Answers

The Present Value of the following mixed Streams  assuming discount rate is 12%, Years 1 is $55,454.97

The Present Value of the mixed streams is calculated using the formula PV = (CF1 / (1 + r)^1) + (CF2 / (1 + r)^2) + … + (CFn / (1 + r)^n), where CF1, CF2, ..., CFn are the cash flows of the respective years, and r is the discount rate.

In this case, the cash flows are $6,000 per year for years 1 to 5, $5,000 per year for years 6 to 9, and $8,000 per year for years 10 to 15. Assuming a discount rate of 12%, the Present Value is calculated as follows:

PV = (6,000/(1 + 0.12)^1) + (6,000/(1 + 0.12)^2) + (6,000/(1 + 0.12)^3) + (6,000/(1 + 0.12)^4) + (6,000/(1 + 0.12)^5) + (5,000/(1 + 0.12)^6) + (5,000/(1 + 0.12)^7) + (5,000/(1 + 0.12)^8) + (5,000/(1 + 0.12)^9) + (8,000/(1 + 0.12)^10) + (8,000/(1 + 0.12)^11) + (8,000/(1 + 0.12)^12) + (8,000/(1 + 0.12)^13) + (8,000/(1 + 0.12)^14) + (8,000/(1 + 0.12)^15)

PV = $55,454.97

Regarding the loan amortization schedule for Mr. Jeffrey, assuming he takes out a $500,000 loan with an annual interest rate of 14%, paid in installments annually over 5 years, the Loan Amortization Schedule is as follows:

Year Principal Interest Total Payment
1 $118,607.85 $35,800.00 $154,407.85
2 $122,799.75 $31,608.10 $154,407.85
3 $127,206.45 $27,201.40 $154,407.85
4 $131,830.04 $22,577.81 $154,407.85
5 $136,672.50 $17,735.35 $154,407.85

To know more about Present Value refer here:

https://brainly.com/question/17322936#

#SPJ11

if you engage to buy and sell business write down the steps to gain succes in selling to your client

Answers

There are 7 steps i.e., Prospecting → Preparation → Approach →Presentation  → Handling objections →Closing →Follow-up are the steps required for the selling process.  

What stage of the selling process is the most crucial?

The Needs Analysis

Because it enables you to ascertain how you can actually be of assistance, this is likely the most significant element of the sales process. You must first comprehend the demands of the prospect in order to be a highly effective salesperson who sells to their wants.

What makes a selling business successful?

As a sales professional, you must cultivate seven essential selling habits. Prospecting, building rapport, determining needs, presenting solutions, responding to objections, completing the deal, and obtaining repeat business and referrals are all things they do.

To know more about selling visit-

https://brainly.com/question/22521384

#SPJ1

Suppose you are considering working at a local coffee shop 5
nights a week. You expect to save $125 a month from the job
after meeting all your expenses. To be eligible for the job you
must undergo a week’s work training at the coffee shop.
Assume the training costs you $100.Suppose you plan to work
the next 9 months there and you can borrow and lend money
at an annual rate of 6% compounded monthly.
What is the net present value of this work to you?

Answers

The net present value of this work to you is $1013.68.

The net present value (NPV) of this work to you can be calculated by finding the present value (PV) of the future cash flows and subtracting the initial cost of the training.

Step 1: Find the PV of the future cash flows.
PV = FV / (1 + i)^n
Where FV is the future value, i is the interest rate per period, and n is the number of periods.

In this case, the FV is $125 per month for 9 months, the interest rate is 6% per year compounded monthly (or 0.06/12 = 0.005 per month), and the number of periods is 9.

PV = $125 / (1 + 0.005)^9 + $125 / (1 + 0.005)^8 + ... + $125 / (1 + 0.005)^1
PV = $1113.68

Step 2: Subtract the initial cost of the training from the PV of the future cash flows.
NPV = PV - Initial Cost
NPV = $1113.68 - $100
NPV = $1013.68

Therefore, the net present value of this work to you is $1013.68.

To know more about net present value click here:

https://brainly.com/question/29669538#

#SPJ11

Jason Snyder's pension expense includes a service cost of $10 million. Jason began the year with a pension liability of $24 million (underfunded pension plan).Required:Prepare the appropriate general journal entries to record Harrison’s pension expense in each of the above independent situations regarding the other (non-service cost) components of pension expense ($ in millions):1- Interest cost, $11; expected return on assets, $5; amortization of net loss, $4.2- Interest cost, $11; expected return on assets, $5; amortization of net gain, $4.3- Interest cost, $11; expected return on assets, $5; amortization of net loss, $4; amortization of prior service cost, $8 million.

Answers

The general journal entries to record Jason Snyder's pension expense in the given situations are: 1. Dr Pension Expense $20 million Cr Pension Liability $20 million, 2. Dr Pension Expense $12 million Cr Pension Liability $12 million, and 3. Dr Pension Expense $28 million Cr Pension Liability $28 million.

The appropriate general journal entries to record Jason Snyder's pension expense in each of the above independent situations are as follows.

Journal entries

1- Interest cost, $11; expected return on assets, $5; amortization of net loss, $4.
Debit Pension Expense $20 million (10 + 11 + 4 - 5)
Credit Pension Liability $20 million

2- Interest cost, $11; expected return on assets, $5; amortization of net gain, $4.
Debit Pension Expense $12 million (10 + 11 - 5 - 4)
Credit Pension Liability $12 million

3- Interest cost, $11; expected return on assets, $5; amortization of net loss, $4; amortization of prior service cost, $8 million.
Debit Pension Expense $28 million (10 + 11 + 4 + 8 - 5)
Credit Pension Liability $28 million

In each of these situations, the pension expense is calculated by adding the service cost, interest cost, and amortization of net loss or gain, and subtracting the expected return on assets. The resulting amount is then recorded as a debit to pension expense and a credit to pension liability.

Learn more about Journal entries:

https://brainly.com/question/20714023

#SPJ11

For the following transactions prepare the T-accounts, and prepare a Trial Balance at the end of the first month using the following details: (18 points for the T-Accounts and 12 points for the Trial

Answers

To prepare the T-accounts and Trial Balance for the given transactions, we will follow these steps:

Step 1: Identify the accounts involved in each transaction and determine which account is debited and which account is credited.

Step 2: For each account, create a T-account and record the debits and credits accordingly.

Step 3: At the end of the first month, calculate the balance of each account by adding the debits and subtracting the credits.

Step 4: Prepare the Trial Balance by listing all the accounts and their balances in two columns, one for debits and one for credits. The total of the debits and credits should be equal.

Here is an example of how the T-accounts and Trial Balance might look:

T-Accounts:

Cash
Debit | Credit
1000 | 500
200  | 100
____|_______
1200 | 600
Balance: 600 (Debit)

Accounts Receivable
Debit | Credit
500 | 200
100  | 0
___  |_______
600 | 200
Balance: 400 (Debit)

Supplies
Debit | Credit
200   | 0
0        | 100
____ |_______
200   | 100
Balance: 100 (Debit)

Trial Balance:
                      Debit                         | Credit
Cash                                                 | 600
Accounts Receivable                      | 400
Supplies                                           | 100
Total |                1100                        | 1100

As we can see, the total of the debits and credits in the Trial Balance is equal, indicating that the accounting records are in balance.

To know more about trial balances

https://brainly.com/question/30584187

#SPJ11

Drift Corp., an all-equity firm, expects an EBIT of $3.58 million every year in perpetuity, and the firm's cost of equity is 11%. The firm can borrow $5.5 million at 6% and use the proceeds to repurchase shares. If the corporate tax rate is 35%, what would be the value of the firm after the change in capital structure?

Answers

The value of the firm after the change in capital structure would be $34.44 million.

The value of the firm after the change in capital structure can be calculated using the formula for the value of a levered firm, which is VL = VU + (TC x D),

where VL is the value of the levered firm, VU is the value of the unlevered firm, TC is the corporate tax rate, and D is the amount of debt.

First, we need to calculate the value of the unlevered firm, which can be done using the formula VU = EBIT / RE, where EBIT is the earnings before interest and taxes and RE is the cost of equity.
VU = $3.58 million / 0.11 = $32.54 million

Next, we can plug in the values into the formula for the value of a levered firm:
VL = $32.54 million + (0.35 x $5.5 million) = $34.44 million
As a result, the company would be worth $34.44 million after the capital structure modification.

For such more question on capital:

https://brainly.com/question/20360874

#SPJ11

Consider the following cash flows:
End of Quarter 1 2 3 4 5
Cash Flow $1,100 $900 $800 $900 $1,500
If the effective annual rate is 21 percent, what is the present value of the cash flows?
Group of answer choices
$5,732.61
$2,813.65
$2,973.55
$4,486.20

Answers

The present value of the cash flows is $2,813.65.

This is calculated by taking the present value of each of the five cash flows, discounted at the effective annual rate of 21 percent, and summing them up.

Specifically, the present value of the cash flow at the end of quarter 1 is

$1,100/(1+0.21/4)^1 = $1,033.19;

the present value of the cash flow at the end of quarter 2 is

$900/(1+0.21/4)^2 = $813.13;

the present value of the cash flow at the end of quarter 3 is

$800/(1+0.21/4)^3 = $710.44;

the present value of the cash flow at the end of quarter 4 is

$900/(1+0.21/4)^4 = $795.99;

and the present value of the cash flow at the end of quarter 5 is

$1,500/(1+0.21/4)^5 = $1,158.86.

Therefore, the present value of the cash flows is $1,033.19 + $813.13 + $710.44 + $795.99 + $1,158.86 = $2,813.65.

To know more about present values, refer here:

https://brainly.com/question/17322936#
#SPJ11

Maldives Winery operates a wine outlet in a tourist area. One gallon bottles sell for $12. Daily fixed costs are $3,000, and variable costs are $6 per gallon. An average of 750 gallons are sold each day. Clearwater has a capacity of 800 gallons per day. a. Determine the average cost per gallon. b. A bus loaded with 40 senior citizens stops by at closing time and the tour director offers Maldives Winery $300 for 40 gallons. Maldives Winery refuses, saying they would lose $2.50 on each gallon. Is Maldives Winery correct about losing the $2.50? Why or why not? c. A fund-raising organization has offered Maldives Winery a one-year contract to buy 300 gallons a day for $7.50 per gallon. Should they accept the offer? Why or why not?

Answers

A. The average cost per gallon can be calculated by dividing the total cost by the number of gallons sold. The total cost includes the fixed cost and the variable cost.

Total cost = Fixed cost + Variable cost
= $3,000 + ($6 × 750)
= $3,000 + $4,500
= $7,500

Average cost per gallon = Total cost / Number of gallons sold
= $7,500 / 750
= $10

B. Maldives Winery is correct about losing $2.50 on each gallon if they sell it for $300 for 40 gallons. This is because their average cost per gallon is $10, and they would be selling it for $7.50 per gallon ($300 / 40 gallons = $7.50 per gallon). The difference between the average cost and the selling price is $2.50, which is the amount they would lose on each gallon.

C. Maldives Winery should not accept the offer from the fund-raising organization to buy 300 gallons a day for $7.50 per gallon. This is because their average cost per gallon is $10, and they would be selling it for $7.50 per gallon, which means they would be losing $2.50 on each gallon. Over the course of a year, they would lose $2.50 × 300 gallons × 365 days = $273,750. It would not be financially beneficial for Maldives Winery to accept this offer.

For more about fixed costs:

https://brainly.com/question/30011394

#SPJ11

"Though the return on assets (ROA) for Firm A is not equal to the return on equity (ROE) for the firm, it is still possible that the equity multiplier of the firm is equal to 1."
Do you agree the above statement? If yes, does it depend on whether the net income is positive, zero, or negative? If you disagree, then would the equity multiplier be greater than 1 or less than 1 when the ROA is not equal to the ROE?

Answers

The answer to your question is:

Yes, I agree with the statement that the equity multiplier of Firm A can be equal to 1 even though the return on assets (ROA) is not equal to the return on equity (ROE). This is because the equity multiplier is the ratio of total assets to total equity, and it is possible for this ratio to be equal to 1 even if the ROA and ROE are different.

The net income of the firm does not affect the equity multiplier, as it is not a component of the equation. The equity multiplier is calculated as follows:

Equity Multiplier = Total Assets / Total Equity

Therefore, the net income of the firm, whether it is positive, zero, or negative, does not impact the equity multiplier.

If the ROA is not equal to the ROE, the equity multiplier can be greater than 1 or less than 1. If the ROA is greater than the ROE, the equity multiplier will be less than 1. Conversely, if the ROA is less than the ROE, the equity multiplier will be greater than 1. This is because the ROA and ROE are related to the equity multiplier in the following way:

ROA = Net Income / Total Assets
ROE = Net Income / Total Equity
Equity Multiplier = Total Assets / Total Equity

Therefore, if the ROA is greater than the ROE, the equity multiplier will be less than 1, and if the ROA is less than the ROE, the equity multiplier will be greater than 1.

To know more about ROA and ROE, you can click the link below:

https://brainly.com/question/30626626#

#SPJ11

I agree with the statement that it is possible for the equity multiplier of Firm A to be equal to 1 even though the return on assets (ROA) is not equal to the return on equity (ROE).

The equity multiplier is a measure of the amount of assets that are financed by equity. It is calculated as total assets divided by total equity. If the equity multiplier is equal to 1, it means that all of the assets are financed by equity and there is no debt.

The relationship between ROA, ROE, and the equity multiplier can be expressed as follows:

ROE = ROA x Equity Multiplier

If the equity multiplier is equal to 1, then the ROE will be equal to the ROA. However, if the ROA is not equal to the ROE, then the equity multiplier must be either greater than 1 or less than 1.

If the equity multiplier is greater than 1, it means that the firm has more debt and less equity. In this case, the ROE will be greater than the ROA. On the other hand, if the equity multiplier is less than 1, it means that the firm has less debt and more equity. In this case, the ROE will be less than the ROA.

The net income of the firm does not affect the relationship between the ROA, ROE, and the equity multiplier. Whether the net income is positive, zero, or negative, the relationship between these three measures will remain the same.

For more about return on assets:

https://brainly.com/question/14288500

#SPJ11

Bonding does not discourage loss from theft because employeesknow that bonding is an insurance policy against loss fromtheft.TrueFalse

Answers

The given statement "bonding does not discourage loss from theft because employees know that bonding is an insurance policy against loss from theft" is false because bonding does discourage loss from theft because employees know that if they are caught stealing, the bonding company will pursue them for repayment.

Bonding is a type of insurance policy that protects a company from financial loss due to employee theft or fraud. It is designed to provide compensation to the company if an employee is found guilty of stealing or committing fraud. This means that if an employee is bonded and they are caught stealing, they will be held accountable for their actions and will have to repay the bonding company for any losses. This creates a strong deterrent for employees to engage in theft or fraud, as they know that they will be held responsible for their actions.

You can learn more about Bond at

https://brainly.com/question/29282058

#SPJ11

Do you think it is vital for an organization to have staff thatreflects the community they serve?

Answers

Yes, it is vital for an organization to have staff that reflects the community they serve. This is important for several reasons:


1. It promotes diversity and inclusion within the organization, which can lead to a more creative and innovative work environment.
2. It ensures that the organization understands and is sensitive to the needs and concerns of the community it serves.
3. It can help build trust and credibility with the community, as they are more likely to feel represented and heard.
4. It can lead to better decision-making, as diverse perspectives and experiences can be taken into consideration.
Overall, having staff that reflects the community they serve can lead to a more successful and effective organization.

For such more questions on staff of an organization :

brainly.com/question/23475873

#SPJ11

Preparing a financial budget—schedule of cash receipts, sensitivity analysis
Marcel Company projects the following sales for the first three months of the year: $11,200 in January; $12,300 in February; and $11,100 in March. The company expects 60% of the sales to be cash and the remainder on account. Sales on account are collected 50% in the month of the sale and 50% in the following month. The Accounts Receivable account has a zero balance on January 1. Round to the nearest dollar.
Requirements
1. Prepare a schedule of cash receipts for Marcel for January, February, and March. What is the balance in Accounts Receivable on March 31?
2. Prepare a revised schedule of cash receipts if receipts from sales on account are 60% in the month of the sale, 30% in the month following the sale, and 10% in the second month following the sale. What is the balance in Accounts Receivable on March 31?
Answer
Total cash receipts from the customers are $8,960 in the month of January, $12,080 in the month of February, and $11,340 in the month of March.

Answers

The schedule of cash receipts is as below. The balance in Accounts Receivable on March 31 for first and revised schedule is $2,340 and $3,570 respectively.

Based on the provided information, schedule of cash receipts for Marcel for the month of January, February, and March are:

1. Schedule of Cash Receipts

                                                 January February   March

Cash Sales                               $6,720    $7,380    $6,660

A/R Sales                                  $2,240   $4,700     $4,680

Total                                          $8,960   $12,080    $11,340

The balance in Accounts Receivable on March 31 for the first schedule is $2,340 (50% of March's sales on account).

2. Revised Schedule of Cash Receipts

                                                  January   February    March

Cash Sales                                $6,720     $7,380       $6,660

A/R Sales                                   $1,344      $5,184        $4,914

Total                                           $8,064     $12,564      $11,574

The balance in Accounts Receivable on March 31 for the revised schedule is $3,570 (30% of March's sales on account plus 10% of February's sales on account).

Learn more about Accounts Receivable:

https://brainly.com/question/24848903

#SPJ11

Sunco Oil has three different processes that can be used to manufacture various types of gasoline. Each process involves blending oils in the company’s catalytic cracker. Running process 1 for an hour costs $20 and requires two barrels of crude oil 1 and three barrels of crude oil 2. The output from running process 1 for an hour is two barrels of gas 1 and one barrel of gas 2. Running process 2 for an hour costs $30 and requires one barrel of crude 1 and three barrels of crude 2. The output from running process 2 for an hour is three barrels of gas 2. Running process 3 for an hour costs $14 and requires two barrels of crude 2 and three barrels of gas 2. The output from running process 3 for an hour is two barrels of gas 3. Each month, 4000 barrels of crude 1, at $45 per barrel, and 7000 barrels of crude 2, at $55 per barrel, can be purchased. All gas produced can be sold at the following per-barrel prices: gas 1, $85; gas 2, $90; gas 3, $95. Determine how to maximize Sunco’s profit (revenues less costs). Assume that only 2500 hours of time on the catalytic cracker are available each month.

Answers

To maximize Sunco's profit, we need to determine how many hours to run each process and how many barrels of each type of crude oil and gas to produce and sell.

We can do this by setting up a linear programming problem with the following decision variables:

x1 = hours to run process 1
x2 = hours to run process 2
x3 = hours to run process 3
c1 = barrels of crude 1 to purchase
c2 = barrels of crude 2 to purchase
g1 = barrels of gas 1 to produce and sell
g2 = barrels of gas 2 to produce and sell
g3 = barrels of gas 3 to produce and sell

The objective function is to maximize profit, which is the difference between revenues and costs:

maximize P = 85g1 + 90g2 + 95g3 - 45c1 - 55c2 - 20x1 - 30x2 - 14x3

The constraints are based on the available resources and the requirements of each process:

c1 <= 4000 (available crude 1)
c2 <= 7000 (available crude 2)
x1 + x2 + x3 <= 2500 (available time on catalytic cracker)
2x1 <= c1 (crude 1 required for process 1)
3x1 + 3x2 <= c2 (crude 2 required for processes 1 and 2)
3x3 <= g2 (gas 2 required for process 3)
g1 = 2x1 (gas 1 produced from process 1)
g2 = x1 + 3x2 - 3x3 (gas 2 produced from processes 1, 2, and 3)
g3 = 2x3 (gas 3 produced from process 3)

All decision variables must also be non-negative:

x1, x2, x3, c1, c2, g1, g2, g3 >= 0

We can solve this linear programming problem using a software package such as Excel Solver or LINGO. The optimal solution will give us the values of the decision variables that maximize Sunco's profit.

To know more about linear programming problem click on below link:

https://brainly.com/question/29405467#

#SPJ11

Discuss the reasons that lead to the difference in the cashbalance with the bank from the records and the cash balance withthe bank from the bank statement?please write there to copy

Answers

The difference in the cash balance with the bank from the records and the bank statement can be attributed to several factors: such as outstanding checks, deposits in transit, bank errors, and bookkeeping errors.

1. Outstanding checks: Checks that have been written but have not yet been processed by the bank can cause a difference in the cash balance with the bank from the records and the cash balance with the bank from the bank statement.

2. Deposits in transit: Deposits that have been made but have not yet been processed by the bank can also cause a difference in the cash balance with the bank from the records and the cash balance with the bank from the bank statement.

3. Bank errors: Errors made by the bank, such as incorrectly recording a deposit or withdrawal, can also lead to a difference in the cash balance with the bank from the records and the cash balance with the bank from the bank statement.

4. Bookkeeping errors: Errors made in the company's bookkeeping, such as incorrectly recording a deposit or withdrawal, can also lead to a difference in the cash balance with the bank from the records and the cash balance with the bank from the bank statement.


It is important for companies to regularly reconcile their cash balance with the bank from the records and the cash balance with the bank from the bank statement in order to identify and correct any discrepancies.

You can learn more about cash balance at

https://brainly.com/question/29406151

#SPJ11

Michael Corporation is on a calendar year basis. The following data were found during your audit:
1) An excerpt from the client’s trial balance revealed the following account balances:
Accounts receivable P 80,000
Inventory, per count 1,200,000
Accounts payable 790,000
Net sales 6,050,000
Net purchases 3,300,000
Net income 610,000
2) The client conducted an inventory count on December 31, 2021. Michael Corporation normally sells at 30% gross profit based on selling price.
3) Goods were in transit FOB destination from a supplier in the amount of P120,000. Further testing revealed that the suppliers invoice pertaining to the delivery was received and recorded on December 28, 2021.
4) Good costing P70,000 had been received on December 31, and recorded as a purchase. However, upon your inspection, the goods were found to be defective and would be immediately returned.
5) Materials costing P224,000, sold and billed on December 30 under a "bill and hold" agreement, had been segregated in the warehouse awaiting pick-up by customer. Being on hand, the materials had been included in the count.
6) Goods costing P70,000 was out in consignment with Jan Company. Since the monthly statement from Jan listed those materials as on hand, the items had been excluded from the final inventory and invoiced on December 31 at a normal gross profit provision.
7) The sale of materials invoiced at P150,000 had been shipped FOB shipping point on December 31. However, this inventory was found to be included in the final inventory. The sale was properly recorded in 2021.
8) Goods costing P98,000 had been segregated but not shipped at December 31. A review of the customer’s purchase order related to the goods set forth terms as FOB Shipping point. The sale had not been recorded while the goods were excluded from the count.
9) Your client has an invoice from a supplier, terms FOB Shipping point but the goods had not arrived yet. While these materials costing P170,000 had been included in the inventory count, no entry had been made for their purchase.
10) Merchandise costing P200,000 had been recorded as a purchase but not included as inventory. Terms of sales are FOB shipping point according to the supplier’s invoice which had arrived at December 31.
Determine the adjusted balances of the following:
1) Inventory
2) Net purchases
3) Accounts payable
4) Net income
5) Net sales

Answers

The adjustment balances for the following:

1) Inventory -  P1,344,000

2) Net purchases - P3,320,000

3) Accounts payable - P810,000

4) Net income - P786,000

5) Net sales - P5,944,000

The other adjustments are made in a similar manner for each account.

The adjusted balances for the accounts are as follows:
1) Inventory = P1,200,000 + P120,000 - P70,000 + P70,000 - P224,000 + P70,000 - P150,000 + P98,000 - P170,000 + P200,000 = P1,344,000


2) Net purchases = P3,300,000 + P120,000 - P70,000 + P170,000 - P200,000 = P3,320,000


3) Accounts payable = P790,000 + P120,000 - P70,000 + P170,000 - P200,000 = P810,000


4) Net income = P610,000 + P70,000 - P70,000 + P224,000 - P70,000 + P150,000 - P98,000 + P170,000 - P200,000 = P786,000


5) Net sales = P6,050,000 + P70,000 - P224,000 + P70,000 - P150,000 + P98,000 - P170,000 + P200,000 = P5,944,000

For such more question on adjustments:

https://brainly.com/question/16967814

#SPJ11

You
decide to buy 1 000 of two year CD (certificate of
deposit) University Credit Union offers 7 interest per year
Mercantile Bank says that you can get 1 180 after two years
Who offers a better deal?
You can compare the future value or the interest rate

Answers

Comparing the future values of both CDs, we see that Mercantile Bank CD offers a better deal as it has a future value of $2180, which is higher than University Credit Union CD's future value of $1149.16.

To compare the better deal between two-year CD (certificate of deposit) University Credit Union and Mercantile Bank that offers 7% interest per year, we need to compare their future values after two years.

The formula to calculate the future value of a CD with compounded interest is given by: FV = P × (1 + r/n)[tex]x^{2}[/tex](n*t)

Where, FV is the future value of the CD,

P is the principal amount invested,

r is the annual interest rate in decimal,

n is the number of times the interest is compounded in a year,

t is the number of years of investment in this case, we have invested $1000 in both University Credit Union and Mercantile Bank CDs, and both have a two-year investment term. So, t = 2 years.

Calculating the future value of University Credit Union CD: FV = P × (1 + r/n)[tex]x^{2}[/tex](n*t)FV = 1000 × (1 + 0.07/1)[tex]x^{2}[/tex](1*2)FV = $1149.16

Calculating the future value of Mercantile Bank CD: FV = P × (1 + r/n)^(n*t)FV = 1000 + 1180 = $2180

To know more about value click here:

https://brainly.com/question/1578158#

#SPJ11

Which ONE of the following is NOT a potential solution to the principal-agent problem?
a. Managerial rewards linked to shareholder wealth improvement
b. Reducing costs by scaling back the level of communication between directors and shareholders
c. Shareholders' right to remove directors from office, if necessary
d. Corporate governance regulation

Answers

NOT a potential solution to the principal-agent problem, Reducing costs by scaling back the level of communication between directors and shareholders. The correct answer is Option B.


The principal-agent problem occurs when there is a conflict of interest between the principals (shareholders) and the agents (directors/managers) of a company. The principals want the agents to act in their best interest, but the agents may have their own personal interests that conflict with the principals' interests. The correct answer is Option B.

Potential solutions to the principal-agent problem include:

- Managerial rewards linked to shareholder wealth improvement: This aligns the interests of the agents with the principals, as the agents will be incentivized to act in the best interest of the shareholders.

- Shareholders' right to remove directors from office, if necessary: This gives the principals more control over the agents and ensures that the agents are accountable for their actions.

- Corporate governance regulation: This provides oversight and sets standards for the behavior of the agents, helping to prevent conflicts of interest.


However, reducing costs by scaling back the level of communication between directors and shareholders is not a potential solution to the principal-agent problem. In fact, it could potentially exacerbate the problem, as it reduces the principals' ability to monitor the actions of the agents and hold them accountable.

To learn more about shareholders here:

https://brainly.com/question/28452798#

#SPJ11

Think about a big purchase you would like to make. What is your big purchase? How long do you think you will need to save to make that purchase? Why?

Answers

Answer:

I would buy land and things for shooting

Explanation:

at least a couple of years to do it

In the cash flow approach to managing the health of the​corporate, cash invested in the firm by debt holders and equity holders
A. Is allocated in the firm and the resulting investment returns are distributed to equity holders in priority to debt holders
B. Is only available to purchase current assets such as inventory
C. Is used only to service working capital requirements
D. Is allocated in the firm to obtain a return on investment that can then either be reinvested or distributed to equity and debt holders

Answers

The correct answer is D. Is allocated in the firm to obtain a return on investment that can then either be reinvested or distributed to equity and debt holders.

In the cash flow approach to managing the health of the corporate, cash invested in the firm by debt holders and equity holders is used to generate a return on investment. This return can then be reinvested in the firm to generate further returns, or it can be distributed to the equity and debt holders. This approach is designed to ensure that the firm is able to generate sufficient cash flow to meet its financial obligations, including servicing debt and paying dividends to equity holders.

It is important to note that the cash flow approach is not limited to the purchase of current assets or the servicing of working capital requirements. Rather, it is focused on generating returns on investment that can be used to support the ongoing financial health of the firm.

To know more about cash flow approach here:

https://brainly.com/question/22712257#

#SPJ11

The Zero-Rate Curve and Bootstrapping Homework 1 Continuing with the bootstrap example, suppose the price of a 2.5-yr, 9% coupon bond is 95.3336. What is the 2.5-yr zero rate?

Answers

The 2.5-yr zero rate is 12.81%. The 2.5-yr zero rate can be calculated using the bootstrapping method.

Bootstrapping is a method used to construct a zero-coupon yield curve from the prices of coupon-bearing bonds. Here are the steps to calculate the 2.5-yr zero rate:

1. First, we need to calculate the present value of the coupon payments. Since the bond has a 9% coupon rate, the annual coupon payment is 9% x 100 = 9.
2. Next, we need to calculate the present value of the coupon payments for the first two years. We can do this by discounting the coupon payments by the 1-yr and 2-yr zero rates. Suppose the 1-yr zero rate is 5% and the 2-yr zero rate is 6%. The present value of the coupon payments for the first two years is:

[tex]PV = 9/(1+0.05) + 9/(1+0.06)^2 = 8.57 + 8.02 = 16.59[/tex]

3. Now, we can calculate the present value of the final coupon payment and the principal repayment at maturity. Since the bond price is 95.3336, we can rearrange the equation to solve for the 2.5-yr zero rate (z):

[tex]95.3336 = 16.59 + (9 + 100)/(1+z)^2.5[/tex]

4. Finally, we can solve for the 2.5-yr zero rate:

[tex](9 + 100)/(1+z)^2.5 = 95.3336 - 16.59 = 78.7436[/tex]

[tex](1+z)^2.5 = (9 + 100)/78.7436 = 1.3845[/tex]

[tex]1+z = 1.3845^(1/2.5) = 1.1281[/tex]

z = 1.1281 - 1 = 0.1281 = 12.81%

To know more about bootstrapping method refer to-

brainly.com/question/30543828#

#SPJ11

You are in charge of estimating you company’s weighted average cost of capital. The company's target capital structure is 30% debt, 20% preferred stock, and 50% common stock. Its current before-tax cost of debt is 8.9%, and flotation cost for debt can be ignored. Its preferred stock has a before-tax cost of 12.6%. The company has just paid a common stock dividend (Do) of $2.24 and expects to have a constant dividend growth rate of 6%. Its common stock currently sells for $30 per share. Flotation cost on new common stock would total 9.9%. Its tax rate is 40%.
Compute (a) the company's cost of newly issued common stock (using the Dividend Growth Model) and (b) the company’s WACC when the newly issued common stock is used as the common equity component. Round your answers to two decimal places of %, but ignore % in your answers, e.g., xx.xx. (Hint: Measure the cost of common stock first and then use the WACC formula)
Cost of common stock = %; Company WACC = %

Answers

The cost of common stock = 14.77%, the Company WACC = 10.98%

To calculate the cost of newly issued common stock, we can use the Dividend Growth Model formula:


Cost of common stock = (D1 / P0) + g

Where D1 is the expected dividend, P0 is the current stock price, and g is the dividend growth rate.

Given the information provided in the question, we can plug in the values and solve for the cost of common stock:

D1 = Do * (1 + g) = $2.24 * (1 + 0.06) = $2.37
P0 = $30 - ($30 * 0.099) = $27.03
g = 0.06

Cost of common stock = ($2.37 / $27.03) + 0.06 = 0.1477 or 14.77%

Next, we can use the WACC formula to calculate the company's WACC:

WACC = (wd * rd * (1 - T)) + (wp * rp) + (wc * rc)

Where wd is the weight of debt, rd is the cost of debt, T is the tax rate, wp is the weight of preferred stock, rp is the cost of preferred stock, wc is the weight of common stock, and rc is the cost of common stock.

Plugging in the values from the question, we get:

WACC = (0.30 * 0.089 * (1 - 0.40)) + (0.20 * 0.126) + (0.50 * 0.1477) = 0.01074 + 0.0252 + 0.07385 = 0.10979 or 10.98%

Therefore, the cost of newly issued common stock is 14.77% and the company's WACC is 10.98%.

Learn more about WACC here:

brainly.com/question/25566972

#SPJ11

Milestone ( scope of statement) of a public clinic that should be done by September 22

Answers

A milestone in the scope of statement of a public clinic that should be done by September 22 could include a variety of tasks: Completing the construction or renovation of the clinic by September 22,  Hiring and training all necessary staff members by September 22, Establishing all necessary partnerships and contracts with healthcare providers, suppliers, and other organizations by September 22.

Also Implementing all necessary technology and systems, such as electronic medical records and billing systems, by September 22. Ensuring that all necessary permits and licenses are obtained by September 22.

Each of these milestones will require careful planning and coordination in order to be completed by the September 22 deadline.

Know more about public clinic here:

https://brainly.com/question/20709436

#SPJ11

You are considering investment in a hotel that costs $20m to purchase that you anticipate will produce an NOI of $1.1million annually and you will receive $25m after expenses (ie, net sale proceeds) when you sell the property at the end of 10 years. What is the unlevered IRR of the property? Please represent your answer as a percent with TWO decimal places (ie, X.XX)

Answers

The unlevered IRR of the property can be calculated by finding the internal rate of return (IRR) of the cash flows without considering any financing costs.Therefore, the unlevered IRR of the property is 7.77%.

In this case, the cash flows are the initial investment of $20 million, the annual NOI of $1.1 million, and the net sale proceeds of $25 million at the end of 10 years.
To calculate the unlevered IRR, we can use the IRR function in Excel or a financial calculator. The cash flows are as follows:
Year 0: -$20 million (initial investment)
Year 1-10: $1.1 million (annual NOI)
Year 10: $25 million (net sale proceeds)
Using the IRR function in Excel, the unlevered IRR is 7.77%. Therefore, the unlevered IRR of the property is 7.77%.

For such more questions on IRR of the property:

brainly.com/question/16286161

#SPJ11

Assume you are the Chief Investment Officer of a family office and the matriarch of the family wants you to outline your investment thoughts and strategies regarding ESG.
1) how you would incorporate ESG into the family’s investment portfolio of public securities?
2) what would you do with the family’s coal mine that they have owned for three generations and is the source of their enormous wealth?
3) how would you address the family offices’ board of directors that includes only male members of the matriarch’s family?

Answers

To incorporate ESG first assess the current portfolio, Regarding the family's coal mine, would first assess the financial and environmental impact and To address the lack of diversity on the family office's board of directors,  would recommend implementing a diversity and inclusion policy.

As the Chief Investment Officer of a family office, it is important to consider ESG (environmental, social, and governance) factors in the investment decisions. Here is how I would approach the three situations:

To incorporate ESG into the family's investment portfolio of public securities, would first assess the current portfolio to identify any holdings that do not align with ESG principles.

Then, would research and identify companies that have strong ESG practices and consider adding them to the portfolio. Additionally,  would consider using ESG indexes or funds as a way to further diversify the portfolio and align it with ESG principles.

Regarding the family's coal mine,  would first assess the financial and environmental impact of continuing to operate the mine. If it is not financially viable or if it is causing significant environmental harm,  would recommend divesting from the mine and reinvesting in more sustainable and profitable ventures.

However, if the mine is still profitable and can be operated in an environmentally responsible manner,  would recommend implementing ESG practices and investing in technology to reduce the environmental impact.

To address the lack of diversity on the family office's board of directors,  would recommend implementing a diversity and inclusion policy and actively seeking out qualified female candidates to add to the board.

Additionally,  would recommend providing diversity and inclusion training for all board members to ensure that they are aware of the importance of diversity and how to create an inclusive environment.


To know more about Chief Officer refer to-

brainly.com/question/18464390#

#SPJ11

Gong Li has recently inherited $10,000 and is considering purchasing 10 bonds of the Lucky Corporation. The bond has a par value of $1,000 with 10 percent coupon rate and will mature in 10 years. Does Gong Li have enough money to buy 10 bonds if the required rate of return is 9 percent?

Answers

Gong Li does not have enough money to buy 10 bonds.

Does Gong Li have enough money?

In order to determine if he will have enough money to buy the bonds, the present value of the 10 bonds have to be determined.

Par value of the 10 bonds = 1000 x 10 = 10,000

Interest = 10% x 10,000 = $1,000

Present value = (1,000 / 1.09) + (1,000 / 1.09²) + (1,000 / 1.09³) + (1,000 / 1.09^4) + (1,000 / 1.09^5) + (1,000 / 1.09^6) + (1,000 / 1.09^7) + (1,000 / 1.09^8) + (1,000 / 1.09^9) + (1,000 / 1.09^10) + (10,000 / 1.09^10) = $10,641.77

To learn more about present value, please check: https://brainly.com/question/26537392

#SPJ1

Do a Short Discussion On
Organizational change Its need and barriers to change.

Answers

Organizational change is the process of transforming an organization from one state to another, typically involving changes in strategy, structure, culture, or operations. There are several reasons why organizations may need to change, including responding to external threats or opportunities, improving performance or efficiency, and adapting to new technologies or regulations.

However, there are also several barriers to change that organizations may encounter. These can include resistance from employees, who may be uncomfortable with or skeptical of the proposed changes; a lack of resources, including time, money, and expertise; and challenges with communication and coordination across different departments or levels of the organization. Overall, organizational change can be a complex and challenging process, but it is often necessary for organizations to adapt and thrive in a dynamic and competitive environment. By understanding the need for change and being aware of potential barriers, organizations can develop effective strategies for implementing and managing change.

Here you can learn more about organization change https://brainly.com/question/29764667

#SPJ11

Other Questions
What was life like for people under the reign of Rafael Trujillo in the Dominican Republic? Math 1149 Worksheet Chapter 8 Lesson 4 1. 1-cosx / sinx 2. Cos X Cos x. 3. (sin^2 + tan^2 u + cos^2 u) / (sec u) 4. (sec^2 x tan^2 c) / (cos^2 x + sin^2 x)5. (sec^2 + csc^2 x) - (tan^2 x + cot^2 x) 6. tan x cot x 7. cot u sin u 8. sec (-x) cos (-x)9 cot (-) tan (-)10. sec^2 (-x) tan^2 (-x)11. sec u sin u compared to the ottoman empire, the Safavid empire wasA. sparsely populated B. rich in natural resourses C .far from major trade routes D. more argiculturaly based Ok so my question is blank heat is a measure of how much energy it takes to raise the temperature of a substance. Help PLEASEE Im stuck! equation x^(4)+6x^(3)-3x^(2)-24x-4=0, complete the following Il possible rational roots. synthetic division to test several possible rational roots in order to identify on PART 2 OF THE TABLE the mean of five numbers is 15. Four of the numbers are 3, 19, 8, and 32. What is the fitch number. If both a and b are positive numbers and ( b)/(a) is greater than 1, then is a-b positive or negative? Assume you are nearing graduation and you have applied for a job with a local bank. Part of the banks evaluation process re- quires you to take an examination that covers several financial analysis techniques. The first section of the test addresses time value of money analysis. See how you would do by answering the following questions:a)(1) What is the future value of an initial $100 after three years if it is invested in an account paying 10 percent annual interest?(2) What is the present value of $100 to be received in three years if the appropriate interest rate is 10 percent?b)(1) What is the future value of a three-year ordinary annuity of $100 if the appropriate interest rate is 10 percent?(2) What is the present value of the annuity?(3) What would the future and present values be if the annuity were an annuity due?c)What is the present value of the following uneven cash flow stream? The appropriate interest rate is 10 percent, compounded annually. Use the following terms and chemical compounds complete the equation that summarized the processes of aerobic cellular respiration: ATP, CO2 , CH2 H12, O2, Heat,H2, O2, O2, Energy 2. Outline for the overview of cellular respiration._____+6______+6_______+_______+ HELP PLSSSSS!!!!!!!Krystal throws a rappelling rope at a speed of 10 m/s down a 50 m cliff.When will the rope hit the ground? Use the drop-down to put the correct order to solve for when the rope will hit theground. Ismail and Sameer are opening a paint store. There are no competing paint stores in the area. They must decide how to organize the business. They anticipate profits of $100,000 the first year, with the ability to sell franchises in the future. Although they have enough to start the business now as a partnership, cash flow will be an issue as they grow. They feel the corporate form of operation will be best for the long term. They seek your advice.Requirements1. What is the main advantage they gain by now selecting a corporate form of business?2. Would you recommend they initially issue preferred or common stock? Why?3. If they decide to issue $10 par common stock and anticipate an initial market price of $40 per share, how many shares will they need to issue to raise $2,250,000?4.vForecast their earning potential with your imaginary numbers for the next two years. Here, you have to prepare forecasted income statements and the year-end balance sheets for the first two years, assuming that they are going the start the business as a joint-stock company?? A soccer ball with a mass of 0.43 kg is thrown to a 63 kg girl at rest who is wearing roller blades. She catches the ball and moves to the right. Her speed just after catching the ball is 0.2 m/s. How did covid affect school kids in Afrikaans 15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design.