A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer 1

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.


Related Questions

Which is a characteristic of life that is only found in living things?


made of cells

made of cells

able to use energy

able to use energy

able to move

able to move

made of carbon compounds

Answers

All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life.

Question 1(Multiple Choice Worth 2 points)(05.05 MC)How does the human immune system initially respond to a pathogen?

Answers

Immediately, the pathogen has been recognized:

Macrophages acts as the first line of defence by engulfing pathogens identified by antigens which will now present the antibody shape to a helper T cell.

The Helper T cells produce a signal to plasma and Memory B cells to yield antibodies that attach to the antigens. The cytotoxic cells that leads to cell death are activated by the helper T cells.

Antibodies helps to immobilize pathogen for macrophage to feed on.

if the pathogen comes back a 2nd time the memory cells helps in quick and efficient recovery by producing the specific B and T cells for the antigen.

Water is reabsorbed during filtration by renal capillaries.​

Answers

Answer:

Most of the solutes get reabsorbed in the PCT by a process called tubular reabsorption. In the loop of Henle, the filtrate continues to exchange solutes and water with the renal medulla and the peritubular capillary network. Water is also reabsorbed during this step.

Explanation:

Hope this helps...

The size of the cell is related to its function True/false

Answers

ANSWER:

TRUE

EXPLANATION:

BECAUSE THE SIZE OF THE CELL IS RELATED TO ITS FUNCTION.

HOPE IT HELPS YOU

CAN YOU BRAINLEST ME

Answer:

For example, the nerve cells are elongated in shape and are thin and dainty. ... An animal cell does not have a cell wall

Explanation:

The size and shape of a cell are related to its function and are governed by four factors—(1) surface-volume ratio, (2) nucleocytoplasmic ratio, (3) rate of cellular activity, (4) cell associations. (1) Surface-volume Ratio: ADVERTISEMENTS: The cell membrane separates the inner content from the outer environment.

3-5 sentences for each question pls !!! need help ASAP
2. A volcano erupts 40 miles from an owl’s ecosystem. Ash from the eruption blocks sunlight over your ecosystem for several (7-10) months.
a. Explain what happens within the food web in the weeks that follow the eruption.
b. The ash clears and several more months go by. What do you think will happen to your ecosystem?

Answers

Answer:

a. Sunlight cannot penetrate through the ash clouds. thus photosynthesize won't occur. so the food chain will begin to collapse from the producer and primary consumer. owls will be out thinking that it's night. they will catch fish resulting in an imbalanced ecosystem. the aquatic population will decrease. then it's the doom days for owls. they will emigrate or will die.

b. the ecosystem will restore. that's how nature works.

The volcanic eruption destroyed the owl ecosystem because it prevented the sun's light from entering, so the food web of the ecosystem was destroyed because there was no food, and a new ecosystem will grow after many months.

What is the ecosystem?

The ecosystem has both biotic and abiotic components, and there are many food chains and food webs present in the ecosystem, so the volcanic eruption harmed the ecosystem and killed the populations present, but after many months, when the ashes from the volcanic eruption are cleared, a new population will grow and a new community will be seen.

Hence, the volcanic eruption destroyed the owl ecosystem because it prevented the sun's light from entering, so the food web of the ecosystem was destroyed because there was no food, and a new community will grow after many months.

Learn more about the ecosystem and volcanic eruption here.

https://brainly.com/question/18403882

#SPJ2

4. Which structure is not unique to plant cells?

Answers

Answer:

The plant cell has a plant wall Chloroplast.

Explanation:

this is not found in animal cells.

Answer:

lysomes or centrosomes

in the overall reactions of photosynthesis, the electrons from _____ are used to reduce _____.

Answers

In the overall reactions of photosynthesis, the electrons from water are used to reduce carbon dioxide.

During photosynthesis, electrons from water molecules are used to reduce carbon dioxide and fix it into carbohydrates while oxygen is produced as a result. The process happens with the help of radiant energy.

Even though the process of photosynthesis is a series of reactions that have been divided into light-dependent and light-independent, the overall equation of the process is written as:

               [tex]6H_2O + 6CO_2 ---> C_6H_1_2O_6 + 6O_2[/tex]

More on photosynthesis can be found here: https://brainly.com/question/1388366

a population characteristic, such as a population mean, is called

Answers

Answer:

Parameter

Explanation:

Every Characteristic a population has is called a Parameter

tell us one way that saturated fats and unsaturated fats are different.

Answers

One difference is the number of double bonds in the fatty acid chain

Describe the use of carbohydrates and lipids for energy
storage in animals.

Answers

Answer:

Animals tend to use carbohydrates primarily for short-term energy storage, while lipids are used more for long-term energy storage. Carbohydrates are stored as glycogen in animals while lipids are stored as fats (in plants carbohydrates are stored as cellulose and lipids as oils)

Explanation:

Sana po makatulong pa mark na din po Brainliest hehe

Animals tend to use carbohydrates primarily for short-term energy storage. Carbohydrates are stored as glycogen in animals while lipids are stored as fats

how long does it take to recover from appendix surgery

Answers

two to four weeks, that's what l was told by my teacher

Construct an explanation for that carbon hydrates are considered as a source of energy for the human body. Justify your answer with an evidence with your own words.


Please help out I’ll mark as brainlist

Answers

Explanation: Carbohydrates are mainly composed of Oxygen, Carbon and Hydrogen. the most popular carbohydrate that is compatible with the human body is glucose which is the final result of every Carb we take in. a glucose molecule has 6 carbon atoms. during glycolysis, a single glucose molecule is broken down into two pyruvate molecules. in there, the first couple of ATP is synthesized. at later steps of the cycle, more ATP molecules are reduced.

B. What structures are missing from the root hair cells?

Answers

Answer:

The function of root hairs is to collect water and mineral nutrients that are present in the soil and take this solution up through the roots to the rest of the plant. As root hair cells do not carry out photosynthesis, they do not contain chloroplasts.

Explanation:

Mitochondria are missing from root hair cells.

Root hair cells are specialized plant cells found in the roots of plants. Their primary function is to absorb water and minerals from the soil. To achieve efficient absorption, root hair cells have evolved specific structural adaptations.

Root hair cells are elongated and have a large surface area due to their elongated projections called root hairs. This increased surface area enhances their ability to come into contact with the soil, maximizing water and nutrient absorption. However, due to their focus on absorption and their short lifespan, root hair cells exhibit some structural simplifications, such as the absence of certain organelles.

One notable organelle missing from root hair cells is the mitochondria. Mitochondria are the "powerhouses" of cells, responsible for generating energy in the form of ATP through cellular respiration. Since root hair cells are mainly involved in absorption rather than energy production, they have a reduced need for extensive energy generation. As a result, they don't require as many mitochondria as other cells that are highly metabolically active.

To learn more about root hair cells, here

https://brainly.com/question/21682037

#SPJ3

what pathogen causes TMV

Answers

Answer:

The tobacco mosaic virus infects tobacco and lots of other closely related species like tomatoes and peppers. It is transmitted by contact between plants, either naturally or on the hands of farmers. It infects the chloroplasts of plant leaves and changes their colour from green to yellow or white in a mosaic pattern.

NEED HELP ASAP PLEASEEE!!
Which item is NOT part of an effort to reduce health care workers exposure to hazardous chemicals?
A: protective storage
B: sterilization agents
C: pre-measured doses
D: needleless administration

Answers

Answer:

D: needleless administration

Explanation:

Answer: sterilization agents

Explanation:

Just the assignment

what would happen to a signaling pathway if phosphatases had reduced levels of function?

Answers

Phosphates and kinases work together so I’d phosphateses are reduced in function, their function in Signal transduction pathways would be reduced.

Please help me with this question! Right answers only!

Answers

B is the correct answer I hope it’s right

One of the carbohydrates is a building block of a plant's cell wall. It is

Answers

Answer:

hshdghdisuahzggdhxdhdnndnxhdj dhhdgdhdghdgdgehdyjebdjdhdydjshdjudydjdjdjxjxjdjdjdjdjdjdjdjdhdjdhydudueuhhcgduhxydjyduydjdhdyudjddhhdudusudidhdddfrdiiwousiisosooss

Answer:

cellulose is a building block of a plant cell wall

Explanation:

skin can regenerate effectively even after considerable damage has occurred because

Answers

Answer:

Skin can regenerate effectively even after undergoing considerable damage because stem cells persist in both the epithelial and connective tissue components of skin. In response to injury, cells of the stratum basale (germinativum) replace epithelial cells while mesenchymal cells replace lost dermal cells.

Explanation:

yw!

what organelle is made of two layers of phospholipids

Answers

Answer:

The plasma membrane

Explanation:

what happens when the epiphyseal plate is ossified

Answers

Answer:

Bones grow in length at the epiphyseal plate by a process that is similar to endochondral ossification. When cartilage growth ceases, usually in the early twenties, the epiphyseal plate completely ossifies so that only a thin epiphyseal line remains and the bones can no longer grown in length.

Which of the following is required for the sodium-potassium pump to transport potassium ions into an animal cell?

High intracellular concentrations of potassium
High intracellular concentrations of sodium
Low intracellular concentrations of potassium
Energy from ATP

Answers

Answer: Energy from ATP

Explanation:

How do we REMOVE water vapor (a gas) from our atmosphere?

Answers

Answer:

to get the heat of the planet

Explanation:

what would make the earth's plates stop moving

Answers

Answer:

Slab Resistance would make the earth's plates stop moving

Explanation:

Answer:

Brainiest plz and hope this answer helped let me know if you need any more help I am glad to help!

Explanation:

what would make the earth's plates stop moving?

If the earths mantel would be really cold then the earth's plates would stop moving.

Aquifers are ___ . A. Structures used to transport water from city to city

Answers

Answer:

Ground water

Explanation:

ez

Why do endemic species have a greater risk of becoming endangered than widespread species?​

Answers

Answer:

Many rare and/or endemic species exhibit one or more of the following attributes which make them especially prone to extinction: (1) narrow (and single) geographical range, (2) only one or a few populations, (3) small population size and little genetic variability, (4) over-exploitation by people, (5) declining ..

How do genes control characteristics? Please help I’ve got a test tomorrow. Thank you!

Answers

Answer:

the proteins in the gene

Explanation:

Answer:

Genes are sections of DNA that are carried on chromosomes and determine specific human characteristics such as eye color and height.the proteins that genes carry are the ones responsible for controlling these characteristics or traits.

I hope this helps

A dietician asks a patient about the food that the patient eats and makes the table below to summarize the results.MacromoleculeSuggested percentage of dietActual percentage of dietCarbohydrates45–65%70%Lipids20–35%5%Proteins10–35%25%Based on the table, what advice do you think that the dietician will give the patient?The patient should increase the amount of lean meats (proteins) and decrease the amount of oils in his or her diet.The patient should decrease the amount of lean meats (proteins) and increase the amount of oils in his or her diet.The patient should decrease the amount of rice and pasta and increase the amount of oils in his or her diet.The patient should decrease the amount of rice and pasta and increase the amount of lean meats (proteins) in his or her diet.

Answers

Explanation:

The patients to decrease lean meat and increase

The patient should increase the amount of lean meats (proteins) and decrease the amount of oils in his or her diet. Therefore, option "A" is correct.

What are macromolecules?

Monomers are long chains of molecular subunits that comprise macromolecules, essentially polymers. Long polymers are present in proteins, carbohydrates, and nucleic acids. They are called macromolecules because of their large size and polymeric nature.

Macromolecules are able to speed up biochemical reactions, store and retrieve genetic information, provide structural support, and store fuel. The biological macromolecule is carbohydrates, lipids, proteins, and nucleic acids is an essential component of the cell.

Therefore, macromolecules are important for body function.

Learn more about macromolecules, here:

https://brainly.com/question/13277913

#SPJ7

Please help!!! Quickly!!!!

Answers

[tex]▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ { \huge \mathfrak{Answer}}▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ [/tex]

The Correct choice is " a "

Many organisms eat at multiple trophic levels.

Answer:

The feeding relationships of organisms in the real world is almost always more complex than suggested by a food chain. For that reason, the term food web is more accurate than is food

chain.

Explanation:

hope its hepl

alkali metals are listed in the first column of the periodic table. this tells you that

a they are highly reactive

b they have only one electron in their outer orbital shells.

c their nuclei contain only one neutron

d both a and b​

Answers

Answer:

B. they have only one electron in their outer orbital shells

Other Questions
Is this true? (Random Characters) Joshua delivered 30 hives to the local fruit farm. If the farmer has paid to use 5% of the total number of Joshuas hives, how many hives does Joshua have in all? Triangle XYZ has points X = (4,4), Y = (0,1), and Z = (4,4). Triangle X'Y'Z' has points X = (5,4), Y = (1,1), Z = (3,4). What is the transformation of XYZ to X'Y'Z'? Read these lines from the poem and answer the question.The monument sticks like a fishbonein the city's throatIn these lines, the poet suggests thatthe monument should have been torn down along with the aquariumthe monument is not attractivethe monument makes the people of the city uncomfortable because of the history behind itthe monument should have been placed in another part of the city please answer both thank you what is the net ionic equation for ammonium chloride and sodium hydroxide Latitude is measured from the equator in a and a direction and what's it known as Newton uses two properties ti rewrite the expression (4x23)x25 identify the properties he used why would Newton use these properties ANSWER QUICK PLEASE!! combine like terms. 8x + 3 - 5x + 9A. -13x - 12B. 13x + 12C. 3x - 6D. 3x + 12 NO LINKS OR WEBSITES!! Which theme do the actions of Della and Jim suggest most clearly?A. Being wealthy make life easier. B. Love is the greatest gift.C. Beauty is in the eye of the beholder.D. Time heals all wounds. PLEASE I NEED HELP!!! 100 POINTS!!!Food sample "E" tested positive for which tests? Why is the French and Indian War considered a turning point in the relationship betweenBritain and the American colonies? The slope of Consider the line whose equation is 3x + y - 3 = 0. The slope of any line that is parallel to this line is any line that is perpendicular to this line is sarah is taking out a $24,400, 4 year new car loan with an apr of 2.88%. what is the finance charge for this loan? round to the nearest $100 he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. 1. A rectangular canvas picture measures 12 inches by 28 inches. The canvas is mounted inside a frame of uniform width, increasing the total area covered by both canvas and frame to 612 square inches. Find the uniform width of the frame. Please help me. I am from the UK I need numbers to call for abuse. I have no messaging platforms other then this what are the two main ideas from Rain Forest Food Chains. Find the missing side of each triangle.A) 10 cmC) 17.1 cmE) 5.8 cmB) 11.4 cmD) 13.8 cm when do humans use anaerobic respiration