A right triangle has the dimensions below, I have the correct answer however I forgot the formula or how the calculator was able to figure out the answer
the Answer if your curious is 27m2

A Right Triangle Has The Dimensions Below, I Have The Correct Answer However I Forgot The Formula Or

Answers

Answer 1

40 m³ is the volume of pyramid .

What is a pyramid defined as?

A three-dimensional shape is a pyramid. A pyramid's flat triangular faces and polygonal base all come together in a summit known as the apex. By fusing the bases together at the peak, a pyramid is created. The lateral face, a triangular feature formed by the connection of each base edge to the apex, is present.

  L= 5

h = 4

s = 6

V = 6 * 4 * 5/3

   = 120/3

   = 40 m³

Learn more about pyramid

brainly.com/question/13057463

#SPJ1


Related Questions

Match the number in scientific notation to the same number in standard notation.

Answers

Answer:

Step-by-step explanation:

from top to bottom:

1,200

0.012

120

0.00012

If the exponent is positive, move the decimal to the RIGHT the number of spaces equal to the exponent.

If the exponent is negative, move the decimal to the LEFT the number of spaces equal to the exponent.

(B) 5 (C) 6 (D) 9 What is the solution set for the absolute value equation |2x-4|=20?

Answers

The solution set for the absolute value equation |2x-4|=20 is {-14, 14}.

Absolute Value Equation

An absolute value equation is one that contains an absolute value expression, such as ||x| - 1| = 2.

These types of equations are solved by breaking them down into two separate equations and solving each one separately:

one with the original absolute value expression and a positive value for the other side, and the other with the negated absolute value expression and a negative value for the other side.

The steps to solving an absolute value equation are as follows:

1. Write the equation in the form |expression| = value, where expression is the absolute value expression and value is the constant on the right-hand side.

2. Separate the equation into two equations: expression = value and expression = -value.

3. Solve each equation for the variable.

4. Check the solution(s) to ensure that they satisfy the original equation.

Learn more about absolute value here:

https://brainly.com/question/1301718#

#SPJ11

given the growth population model 12000/3+e^-.02(t), what is the initial population and what is the maximum population?

Answers

The initial population for this model is 12,000 and the maximum population is 24,000. The equation 12000/3+e^-.02(t) is used to model population growth.

The initial population and maximum population can be found by examining the growth population model.
The initial population is represented by the term before the exponential function, which in this case is 12000/3. This means that the initial population is 4000.

The maximum population is represented by the term in the denominator of the fraction with the exponential function. In this case, the maximum population is 3. This means that the population will never exceed 3, even as time (t) increases.
In conclusion, the initial population is 4000 and the maximum population is 3 according to the given growth population model.

You can read more about population at https://brainly.com/question/29885712

#SPJ11

Use the properties of equality to find the value of x, in the equation 12(5x-4. 5)=36

Answers

Step-by-step explanation:

12(5x - 4.5) = 36

if that is really correct, then we solve this first by dividing both sides by 12

5x - 4.5 = 3

then we add 4.5 to both sides

5x = 7.5

and finally we divide both sides by 5

x = 1.5

What are the coordinates of D1.5(ABCD) for A(2, 0), B(8, -4), C(4, -6), and D(-5, -10)?

Answers

Answer: To find the coordinates of D1.5(ABCD), we need to perform a dilation with center D and scale factor 1.5 on the coordinates of each point.

The coordinates of point D are (-5, -10). To dilate point A, we can subtract the coordinates of D from the coordinates of A, multiply by 1.5, and then add the coordinates of D back:

D1.5(A) = 1.5[(2, 0) - (-5, -10)] + (-5, -10) = 1.5(7, 10) + (-5, -10) = (6.5, 5)

Similarly, we can dilate points B and C:

D1.5(B) = 1.5[(8, -4) - (-5, -10)] + (-5, -10) = 1.5(13, 6) + (-5, -10) = (14.5, -4)

D1.5(C) = 1.5[(4, -6) - (-5, -10)] + (-5, -10) = 1.5(9, 4) + (-5, -10) = (7.5, 4)

Therefore, the coordinates of D1.5(ABCD) are A'(6.5, 5), B'(14.5, -4), C'(7.5, 4), and D(-5, -10).

Step-by-step explanation:

Can someone answer this, please? I need the help

Answers

Answer:

Proofs attached to answer

Step-by-step explanation:

Proofs attached to answer

A large wooden prism will be covered with spray paint for a prop in a school play. The prop must be painted on all sides. A can of spray paint costs $4.00 and will cover 40 square feet. What is the cost to paint the box ?

Part A: how many full cans of spray paint need to be purchased?

Part B What is the cost to paint the box

Answers

(a) The number of cans of spray paint that needs to be purchased is 3.

(b) The cost to paint the wooden prism is $12.00.

What is the cost of the painting?

To determine the cost of painting the wooden prism, we need to calculate the surface area of the prism and then divide it by the coverage of each can of spray paint.

Let's assume the wooden prism has dimensions of 6 feet by 4 feet by 3 feet.

Part A:

The surface area of the prism can be calculated as follows:

The top and bottom faces have an area of 6 ft x 4 ft = 24 ft² each

The two side faces have an area of 6 ft x 3 ft = 18 ft² each

The front and back faces have an area of 4 ft x 3 ft = 12 ft² each

Therefore, the total surface area of the prism is:

2(24 ft²) + 2(18 ft²) + 2(12 ft²) = 96 ft²

Since each can of spray paint covers 40 ft², we need:

96 ft² ÷ 40 ft²/can = 2.4 cans

We can't purchase a partial can of spray paint, so we need to round up to the nearest whole can.

Therefore, we need to purchase 3 cans of spray paint.

Part B:

The cost of painting the box will be the number of cans required multiplied by the cost per can.

Since we need to purchase 3 cans, the cost will be:

3 cans x $4.00/can = $12.00

Learn more about cost of painting here: https://brainly.com/question/4481538

#SPJ1

Alex draws the scale model shown as a plan for a large wall mosaic. He will use​ 2 cm square tiles to make his mosaic. How many tiles will he​ need? Explain how you found your answer.

Answers

Alex will need 150 tiles to make his mosaic.

What is an area?

The space occupied by any two-dimensional figure in a plane is called the area. The space occupied by the tiles in a two-dimensional plane is called the area of the tiles.

To determine the number of tiles needed to create the mosaic, we need to find out the area of the wall mosaic and then divide it by the area of each tile.

First, let's find the area of the wall mosaic. We can do this by counting the number of squares within the rectangular shape, which is the plan for the mosaic.

By counting, we can see that there are 30 squares in the horizontal direction and 20 squares in the vertical direction. Therefore, the area of the wall mosaic is:

Area of wall mosaic = 30 x 20 = 600 square cm

Now, let's find the area of each tile. The problem tells us that each tile is a square with a side length of 2 cm. Therefore, the area of each tile is:

Area of each tile = 2 x 2 = 4 square cm

Finally, we can find the number of tiles needed by dividing the area of the wall mosaic by the area of each tile:

Number of tiles needed = Area of wall mosaic ÷ Area of each tile

= 600 ÷ 4

= 150

Therefore, Alex will need 150 tiles to make his mosaic.

To know more about an area follow

https://brainly.com/question/30659992

#SPJ9

What is the image of the point (4,8)(4,8) after a rotation of 180^{\circ}180 ∘ counterclockwise about the origin?

Answers

After being rotated 180 degrees anticlockwise around the origin, the picture of the point (4,8) is (-4,-8).

After a 180-degree rotation, where is the image point?

The fixed point is referred to as the rotational centre. The quantity of the rotation is described by the term "angle of rotation," which is measured in degrees. The equivalent of turning a figure 90 degrees anticlockwise is turning it 180 degrees clockwise. Hence, the resulting image of the point is (-1, 2).

How is a 180 degree anticlockwise rotation calculated?

Below are the guidelines for rotation: rotation 90 degrees clockwise: (x,y) results in (y,-x) rotation of (x,y) at 90 degrees anticlockwise results in (-y,x) Rotating (x, y) 180 degrees both clockwise and anticlockwise results in (-x,-y).

To know more about degrees visit:-

https://brainly.com/question/364572

#SPJ1

Write a formula for a linear function​ f(x) that models the​ situation, where x is the number of years after. In 2006 the average adult ate 56 pounds of chicken. This amount will increase by 0. 6 pounds per year until 2011

Answers

The required linear function is (f(x) = 0.6(x - 2006) + 56) and this can be determined by using the arithmetic operations.

Given :

In 2006 the average grownup ate fifty-six kilos of birds.

the amount will increase by means of zero.6 pounds in step with yr till 2011.

To determine the linear feature f(x) following steps can be used

Let 'x' be the number of years.

Then the total number of years since 2006 will be:

= x - 2006

The amount boom in kilos in line with 12 months could be:

= 0.6(x - 2006)

Now, add 56 to the above equation.

= 0.6(x - 2006) + 56

It is a type of function that has a constant rate of change between the independent variable (usually denoted as x) and the dependent variable (usually denoted as y). The general form of a linear function is y = mx + b, where m is the slope or the rate of change, and b is the y-intercept.

Linear functions are commonly used in mathematics, economics, physics, and engineering to model real-world phenomena that have a linear relationship between two variables. For example, the cost of producing a certain number of units of a product may be modeled by a linear function, where the slope represents the cost per unit and the y-intercept represents the fixed costs.

To learn more about Linear function visit here:

brainly.com/question/29774887

#SPJ4

A road map is drawn to a scale of 1mm : 50m calculate:

i) The distance on the map which represents 20km on the road

ii) The distance on the road which correspond to 228 on the map​

Answers

the distance on the map which represents 20 km on the road is 400 mm.the distance on the road which corresponds to 228 on the map is 4.56 km.

What is Scale?

The ratio used to depict the relationship between the dimensions of a model or scaled figure and the corresponding dimensions of the real figure or object is called the scale. On the other hand, a scale factor is a value that is used to multiply all of an object's parts in order to produce an expanded or decreased figure.

Given, A road map is drawn to a scale of 1mm: 50m

i) To find the distance on the map which represents 20 km on the road, we need to use the scale of the map.

Since 1 mm on the map represents 50 m on the road, we can set up a proportion:

1 mm / 50 m = x mm / 20,000 m

Cross-multiplying and solving for x, we get:

x = (1 mm / 50 m) * 20,000 m = 400 mm

Therefore, the distance on the map which represents 20 km on the road is 400 mm.

ii) To find the distance on the road which corresponds to 228 on the map, we can again use the scale of the map.

Since 1 mm on the map represents 50 m on the road, we can set up a proportion:

1 mm / 50 m = 228 mm / x m

Cross-multiplying and solving for x, we get:

x = (228 mm / 1) / (50 m / 1) = 4.56 km

Therefore, the distance on the road which corresponds to 228 on the map is 4.56 km.

Learn more about scale here:

https://brainly.com/question/1287267

#SPJ1

HELP ASAPP!
The parallel lines are marked with "feathers". Find the measures of the angles located at positions a, b, c, d, e, & f.

Answers

Answer:

Step-by-step explanation:

a=70

b=45

c=65

d=45

e=70

f=110

make sure to add degree symbol

Enjoy :)

Let f and g be polynomials of degree 3. Is it true that f ∘ g = g ∘ f?

A. Yes, always

B. No, it's only with polynomials with a degrees of 1

C. It is true in some cases

D. No, never

Answers

The true statement about the polynomials is (b) No, it's only with polynomials with a degrees of 1

How to determine the true statement

Given that the polynomials f and g have a degree of 3

The composition of two functions, f ∘ g (read as "f composed with g"), is not commutative in general, meaning that f ∘ g is not necessarily equal to g ∘ f.

This holds true for polynomials of degree 3 as well.

In fact, if f and g are two different polynomials of degree 3, then f ∘ g and g ∘ f will be different polynomials in general.

The equation f ∘ g = g ∘ f holds true is when f and g are constant polynomials, that is, polynomials of degree 0 or 1.

Read more about polynomial at

https://brainly.com/question/7693326

#SPJ1

Lynn had 1(5)/(8) yards of ribbon. She made 6 identical bows and had 1(1)/(4) yards of ribbon left. How many yards of ribbon did Lynn use to make a bow?

Answers

The number of yards of ribbon Lynn used to make a bow is 1/16 yards.

To find out how many yards of ribbon Lynn used to make a bow, we need to subtract the amount of ribbon she had left from the amount she started with and then divide by the number of bows she made. We can do this using the following steps:

1. Convert the mixed numbers to improper fractions: 1(5)/(8) = 13/8 and 1(1)/(4) = 5/4
2. Subtract the two fractions: 13/8 - 5/4 = 13/8 - 10/8 = 3/8
3. Divide the result by the number of bows: (3/8) / 6 = 3/8 x 1/6 = 3/48 = 1/16

Therefore, Lynn used 1/16 yards of ribbon to make a bow.

Learn more about improper fractions here: https://brainly.com/question/387381.

#SPJ11

The Grade 8 learners decided to start training more. They will either box or grid. There
are 125 Grade 8 learners, and they box and grid in the ratio 3:2. Calculate how many
learners participate in each sport?

Answers

75:50, i hope this helps ^^

justin wants to create a rectangular garden whose area is 81x^(2)-126x square units. If one dimension of the garden is 9x-14 units, what is the length of the other dimension?

Answers

The final answer length of the other dimension of the garden is 9x units.

To find the length of the other dimension of the garden, we need to use the formula for the area of a rectangle:

Area = Length x Width

We are given the area and one dimension, so we can plug those values into the formula and solve for the other dimension:

[tex]81x^2-126x[/tex] = (9x-14)(Length)

To solve for the length, we need to divide both sides of the equation by (9x-14):

Length =[tex](81x^2-126x)/(9x-14)[/tex]

Now we can simplify the right side of the equation by factoring out a common factor of 9x:

Length = (9x)(9x-14)/(9x-14)

The (9x-14) terms cancel out, leaving us with:

Length = 9x

So the length of the other dimension of the garden is 9x units.

To know more about  rectangular dimenson refer here:

https://brainly.com/question/29029038#

#SPJ11

Rearrange the equation y - 4 = x into slope intercept form

Answers

The answer is y=x+4

You would had the 4 to the side with the x on it.

Answer:

Below

Step-by-step explanation:

Slope-intercept form is  :    y = mx + b

y - 4 = x       add 4 to each side of the equation

y = x + 4      Done.

Consider the expression |x+3|5x-2|-(x+3)(4x+3)| a. Rewrite the expression in the form (x+3)|ax+b|

Answers

The expression |x+3|5x-2|-(x+3)(4x+3)| can be rewritten as (x+3)|x-5|.

Consider the expression |x+3|5x-2|-(x+3)(4x+3)|. To rewrite this expression in the form (x+3)|ax+b|, we will need to use the distributive property and combine like terms.

First, let's distribute the (x+3) term:

|x+3|5x-2| - (x+3)(4x+3) = |5x^2 + 13x - 2| - |4x^2 + 15x + 9|

Next, let's combine like terms:

|5x^2 + 13x - 2| - |4x^2 + 15x + 9| = |x^2 - 2x - 11|

Now, we can factor the expression inside the absolute value:

|x^2 - 2x - 11| = |(x+3)(x-5)|

Finally, we can rewrite the expression in the form (x+3)|ax+b|:

|(x+3)(x-5)| = (x+3)|x-5|

So, the expression |x+3|5x-2|-(x+3)(4x+3)| can be rewritten as (x+3)|x-5|.

Learn more about distributive property

brainly.com/question/5637942

#SPJ11

pls help due today plesh

Answers

Answer:

  £67.78

Step-by-step explanation:

Given that rolls come in a package of 20 for £2.87 and ham slices come in a package of 30 for £6.32, you want the minimum cost of enough packs for more than 90 sandwiches, each of which uses 1 roll and 2 ham slices.

Ratios

One package of 20 bread rolls is enough for 20 sandwiches. One package of 30 ham slices is enough for 15 sandwiches. The least common multiple of these numbers is the number of sandwiches that will use a whole number of each of the kinds of packages:

  LCM(20, 15) = 60 = 3·20 = 4·15

Packages

We want to make a number of sandwiches that is more than 90. The least multiple of 60 that is more than 90 is 120.

120 sandwiches will require 120/20 = 6 packages of bread rolls, and 120/15 = 8 packages of ham slices.

Cost

The cost of 6 packages of bread rolls and 8 packages of ham slices is ...

  6×£2.87 +8×£6.32 = £17.22 +50.56 = £67.78

The least Tina can spend on packs of bread and ham is £67.78.

what x-value makes the set of ratios equivalent

Answers

The following values of x, makes the set of ratios equivalent:

2: 3 = 6: 9

4: 7 = 24: 42

(6*2)12: 48 = 3: 12

12: 15 = 16: 20

What are ratios?

The ratio can be used to determine how much of one item is contained in the other by comparing two sums of the same units. Ratios fall into two different groups.

Whereas the second is a part to whole ratio, the first is a part-to-part ratio. The part-to-part ratio demonstrates the link between two independent entities or organisations.

Now here in the 1st set:

2:3 = 6:x

Now, x = 6×3/2

⇒ x = 9

Similarly,

4:7=x:42

⇒ x = 24

The next ratio we have:

2x:48= 3:12

⇒ x = 6

Now, the last ratio,

12:15 = x:20

⇒ x = 16

To know more about ratios, visit:

https://brainly.com/question/13419413

#SPJ1

Use the relationships in the diagrams below to solve for the given variable. Justify your solution with a definition or theorem.

Answers

In the parallelogram given the value for the variable x is deduced as 25°.

What is a parallelogram?

A quadrilateral with two sets of parallel sides is referred to as a parallelogram. In a parallelogram, the opposing sides are of equal length, and the opposing angles are of equal size. Additionally, the interior angles that are additional to the transversal on the same side.

According to the properties of a parallelogram, the vertically opposite angles of a parallelogram is always equation.

The first angle measures 2x + 50°.

The second angle measures 3x + 25°.

They both are placed vertically opposite to each other.

So, the equation will be -

2x + 50° = 3x + 25°

Collect the like terms -

2x - 3x = 25° - 50°

- x = - 25°

x = 25°

Therefore, the value of x is obtained as 25°.

To learn more about parallelogram from the given link

https://brainly.com/question/3050890

#SPJ1

A track runner ran for 15 minutes, walked for 15 minutes, ran for another 20 minutes, and then walked for 10 minutes.

Which graph describes the relationship between runner's total distance and time?

graph with the x axis labeled time in hours and the y axis labeled total distance in miles, with a line segment from 0 comma 0 to 0.25 comma 1.25, a horizontal line segment from 0.25 comma 1.25 to 0.5 comma 1.25, a line segment from 0.5 comma 1.25 to 0.8 comma 2.4, and a horizontal line segment from 0.8 comma 2.4 to 1 comma 2.4
graph with the x axis labeled time in hours and the y axis labeled total distance in miles, with a line segment from 0 comma 0 to 0.25 comma 1.25, a line segment from 0.25 comma 1.25 to 0.5 comma 1.75, a line segment from 0.5 comma 1.75 to 0.8 comma 2.95, and a horizontal line segment from 0.8 comma 2.95 to 1 comma 2.95
graph with the x axis labeled time in hours and the y axis labeled total distance in miles, with a line segment from 0 comma 0 to 0.25 comma 1.25, a horizontal line segment from 0.25 comma 1.25 to 0.5 comma 1.25, a line segment from 0.5 comma 1.25 to 0.8 comma 0.1, and a horizontal line segment from 0.8 comma 0.1 to 1 comma 0.1
graph with the x axis labeled time in hours and the y axis labeled total distance in miles, with a line segment from 0 comma 0 to 0.25 comma 1.25, a line segment from 0.25 comma 1.25 to 0.5 comma 1.75, a line segment from 0.5 comma 1.75 to 0.8 comma 2.95, and a line segment from 0.8 comma 2.95 to 1 comma 3.15

Answers

Answer:

Step-by-step explanation:

graph with the x axis labeled time in hours and the y axis labeled total distance in miles, with a line segment from 0 comma 0 to 0.25 comma 1.25, a line segment from 0.25 comma 1.25 to 0.5 comma 1.75, a line segment from 0.5 comma 1.75 to 0.8 comma 2.95, and a horizontal line segment from 0.8 comma 2.95 to 1 comma 2.95

It's B.

Explanation: I took the test

A product received discounts of 33%, 25%, and 5%. A markup on
cost of 50% was then applied to arrive at the regular unit selling
price of $349.50. What was the original list price for the
product?

Answers

The original list price for the product was $487.09.

To find the original list price for the product, we need to reverse the discounts and markup that were applied to it. Here is a step-by-step explanation:

Start with the regular unit selling price of $349.50.Reverse the 50% markup by dividing by 1.50. This gives us the cost before the markup: $349.50 / 1.50 = $233.00.Reverse the 5% discount by dividing by 0.95. This gives us the price before the 5% discount: $233.00 / 0.95 = $245.26.Reverse the 25% discount by dividing by 0.75. This gives us the price before the 25% discount: $245.26 / 0.75 = $326.35Reverse the 33% discount by dividing by 0.67. This gives us the original list price: $326.35 / 0.67 = $487.09.

Therefore, the original list price for the product was $487.09.

For more information about product, visit:

https://brainly.com/question/25922327

#SPJ11

Write an equation for a line parallel to y = 2 x + 1 and passing
through the point (1,5)

Answers

To find the equation for a line parallel to y = 2x + 1 and passing through the point (1,5), we need to remember that parallel lines have the same slope.

Since the slope of y = 2x + 1 is 2, the slope of the parallel line will also be 2.

Using the point-slope form of a linear equation, we can plug in the given slope and point to find the equation of the parallel line:

y - y1 = m(x - x1)

y - 5 = 2(x - 1)

Simplifying this equation gives us the equation for the parallel line:

y = 2x + 3

So, the equation for the line parallel to y = 2x + 1 and passing through the point (1,5) is y = 2x + 3.

Know more about equations

https://brainly.com/question/22688504

#SPJ11

AB=AD and BC=DX
x = [?]

Answers

In the given figure by using the alternative angles rule we know that x = 82°.

What are alternate angles?

Alternate angles are a unique type of angle in geometry.

The collection of non-adjacent angles on either side of the transversal is known as alternate angles.

Alternative Interior Angles: Angles are created on the inside, or interior, of two other lines when a third line known as the transversal crosses them. These other lines are typically parallel.

The alternate internal angles are those that are perpendicular to one another.

So, in the given figure:

∠ABD = ∠BDC = 35° (Alternate angles)

Then, ∠DBC will be:

82 + 35 + x = 180

117 + x = 180

x = 180 - 117

x = 63°

Then, ∠DBC = ∠BDA = 63° (Alternate angles)

Now, ∠DAB = 63 + 35 + x = 180

= 63 + 35 + x = 180

= 98 + x = 180

= x = 180 - 98

= x = 82°


Therefore, in the given figure by using the alternative angles rule we know that x = 82°.

Know more about alternate angles here:

https://brainly.com/question/26167358

#SPJ1

PLEASE HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
What type of polynomial is: −2/3b*3
A. quadratic
B. linear
C. quartic
D. cubic

Answers

The type of polynomial that - 2 / 3 x b³ is D. Cubic polynomial.

What is a cubic polynomial ?

A cubic polynomial is a type of polynomial function in algebra that has a degree of three. Cubic polynomials can take many different forms and can have multiple real roots, complex roots, or no real roots at all.

A quadratic polynomial contains a degree of 2, a linear polynomial contains a degree of 1, and a quartic polynomial contains a degree of 4. In this case, the highest degree of the variable b is 3, which makes it a cubic polynomial.

Find out more on polynomials at https://brainly.com/question/14779377

#SPJ1

The Kennedy high school cross country running team ran the following distances in recent practices 3.5, miles 2.5, miles 4 miles 3.25 miles, 3 miles, 4 miles and 6 miles find the mean and median of the team's distances

Answers

The result is the mean of 3.9 miles and median of the team's distances is 3.5 miles.

What is mean and median?

Mean and median are two ways to measure the center of a set of numbers. Mean is the average of all the numbers in the set, while median is the middle number in the set. Mean is more affected by extreme values, while median is not. Mean is generally used when data is normal, and median when data is skewed.

Mean and median are both measures of central tendency, or measures of the center of a data set. Both measures are used to summarize a data set, but the mean is more affected by outliers, or extreme values, while the median is not.

The mean of the team's distances is 3.9 miles, and the median is 3.5 miles. To calculate the mean, add all the distances together (3.5 + 2.5 + 4 + 3.25 + 3 + 4 + 6) and divide by the number of distances (7). The result is the mean of 3.9 miles. To calculate the median, first order the distances from least to greatest (2.5, 3, 3.25, 3.5, 4, 4, 6) and take the middle number (3.5). The median of the team's distances is 3.5 miles.

For more questions related to central tendency,

https://brainly.com/question/30218735

#SPJ1

HELP ASAP i would really appreciate it. GIVING 50POINTS please no wrong answers or guesses.

Answers

Answer:

D. x > 0, x ≤ 4, y ≥ 1 and y < 4

What's the expression of this?

Answers

Answer:

[tex](3m + 5n)(9m {}^{2} - 15mn + 25n {}^{2} )[/tex]

Step-by-step explanation:

Greetings!!!

Given expression

[tex]27m {}^{3} + 125n {}^{3} [/tex]

Apply exponents rule

Rewrite 27 as

[tex] = 3 {}^{3} m {}^{3} + 125n {}^{3} [/tex]

Rewrite 125 as 5³

[tex] = 3 {}^{3} m {}^{3} + 5 {}^{3} n {}^{3} [/tex]

Apply exponent rule:

[tex]a {}^{m} b {}^{m} = (ab) {}^{m} \\ = 3 {}^{3} m {}^{3} = (3m) {}^{3} \\ = 5 {}^{3} n {}^{3} = (5n) {}^{3} [/tex]

Apply sum of cubes formula

[tex]x {}^{3} + y {}^{3} = (x + y) (x {}^{2} - xy + y {}^{2} )[/tex]

[tex](3m {}^{3}) + (5n {}^{3} ) = (3m + 5n)((3m) {}^{2} - 3m.5n + (5n {}^){2} ) \\ = (3m + 5n)((3m {}^{2} ) - 3m.5n + (5n {}^{2} ))[/tex]

simplify

[tex] = (3m + 5n)(9m {}^{2} - 15mn + 25n {}^{2} )[/tex]

If you have any questions tag me on comments

Hope it helps!!!

help asap pls!! What should be reason 6 in the following proof?

Answers

Answer:

Step-by-step explanation:

alternate interior angles

More formally:

If two lines and a transversal form alternate interior angles that are congruent, then the two lines are parallel (Since ∠1 = ∠4)

Answer: Alternate Interior Angles Converse

Step-by-step explanation:

If two lines are cut by a transversal so the alternate interior angles are congruent, then the lines are parallel.

Other Questions
Please find the scale scale factor From the candy factory, Stattles candies come in five different colors that are equally distributed (20% orange), and each 14 ounce bag has a random sample of 220 of Stattles. a. Find the mean and standard deviation of the sampling distribution of pb. Calculate the probability that Cindy will get at least 48 orange Stattles in her next 14 ounce bag. Almost all writing fits into one genre or another. This is something that can certainly be debated, and often is. Research the various types of fictional genres, and try to figure out what genre Journey to the Center of the Earth would fit into. Using credible sources, such as .edu, try to find examples or definitions of the genre you choose. After you have done that, look for at least five examples from the novel that fit into the category. The writing you will submit will include:the definition or characteristics of the genre you think the novel fits ina list of five examples from the novel that support the idea that this novel fits into the genre you found Project Option 1-Individually 1 Change the equation to slope intercept form identify the slope and y-intercept of the equation. Be sure to show all your work 2 Describe how you would graph this line using the slope intercept method Be sure to write using complete sentences 4 Graph the function On the graph make sure to label the intercepts. You may graph your equation by hand on a piece of paper and scan 5 Suppose Saf's total profit on lunch specials for the next month is $1.503. The profit amounts are the same $2 for each sandwich and S graphs of the functions for the two months are similar and how they are different 02.03 Key Features of Linear Functions-Option 1 Rubric Requirements Student changes equation to slope-intercept form Student shows all work and identifies the slope and y-intercept of the equation Student writes a description which is clear precise, and correct, of how to graph the line using the slope-intercapt method Student changes equation to function notation Student explains clearly what the graph of the equation represents Student graphs the equation and labels the intercepts correctly Student writes at least three sentences explaining how the graphs of the two equations are the same and how they are different Question 5 (1 point) What best describes the following statements? Statement 1: Smith believed that countries should trust in comparative advantage a decision framework and only restrain trade in a fe the current in a circuit is 0.59 A. The circuit has two resistors connected in series: one is 110 ohms and the other is 130 ohm. What is the voltage in the circuit? Behaviourist theory.meaning of theoryproponentprinciples What compromise created a bicameral legislative branch? What is the exponential function for bacterial growth? PLLEAS HELP SOMEONE I NEED QUICKKSSSS 9. A segment has endpoints at A(-4,2) and B(2,10) . The perpendicular bisector of AB passes through point M, which lies on AB Find the coordinates of 'point M.(pls n ty) what is the negative tu command for dedicar? Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions?