A local middle school adopted a policy for school uniforms. Students can wear black pants or tan pants. They can wear a yellow shirt, a red shirt, a green shirt, or a white shirt. The tree diagram shows the possible outfit choices.

A tree diagram with outcomes B Y, B R, B G, B W, T Y, T R, T G, T W.

How many different choices does a student have when choosing a pair of pants and a shirt?
2
4
8
10

Answers

Answer 1

A student has 8 different choices when choosing a pair of pants and a shirt.

What is probability tree?

Without using intricate calculations, the likelihood of an event occurring is shown using a probability tree diagram. It shows every consequence that an event might have. A probability tree serves the aim of listing all potential outcomes of an event and calculating the likelihood of each one. A probability tree diagram can be used to indicate conditional probabilities or to show a sequence of independent occurrences.

The student can choose from four shirts and two pairs of pants (black or tan) (yellow, red, green, or white). We multiply the number of options for pants by the number of options for a shirt to get the total number of options:

2 choices for pants × 4 choices for a shirt = 8 total outfit choices

Therefore, a student has 8 different choices when choosing a pair of pants and a shirt.

Learn more about probability tree here:

https://brainly.com/question/28916734

#SPJ1


Related Questions

Show that the associationA \mapsto g_{A}is an isomorphism between the space of m x n matrices with coefficients in K and the space of bilinear forms in Km x K​​​​​​​n

Answers

The associationA \mapsto g_{A} is an isomorphism between the space of m x n matrices with coefficients in K and the space of bilinear forms in Km x K​​​​​​​n.

The associationA \mapsto g_{A} is an isomorphism between the space of m x n matrices with coefficients in K and the space of bilinear forms in Km x K​​​​​​​n if it satisfies the following conditions:

1. It is a one-to-one correspondence, meaning that for every matrix A there is a unique bilinear form g_{A} and vice versa.
2. It preserves the structure of the spaces, meaning that the operations of addition and scalar multiplication are preserved.

To show that the associationA \mapsto g_{A} is a one-to-one correspondence, we can start by assuming that g_{A} = g_{B} for two matrices A and B. Then, for any vectors u \in Km and v \in K​​​​​​​n, we have:

g_{A}(u,v) = g_{B}(u,v)

A \cdot (u \otimes v) = B \cdot (u \otimes v)

(A - B) \cdot (u \otimes v) = 0

Since this is true for all u and v, we can conclude that A - B = 0, or A = B. This means that the associationA \mapsto g_{A} is a one-to-one correspondence.

To show that the associationA \mapsto g_{A} preserves the structure of the spaces, we can start by considering the addition of two matrices A and B and the scalar multiplication of a matrix A by a scalar c. Then, for any vectors u \in Km and v \in K​​​​​​​n, we have:

g_{A + B}(u,v) = (A + B) \cdot (u \otimes v) = A \cdot (u \otimes v) + B \cdot (u \otimes v) = g_{A}(u,v) + g_{B}(u,v)

g_{cA}(u,v) = (cA) \cdot (u \otimes v) = c(A \cdot (u \otimes v)) = c g_{A}(u,v)

This means that the associationA \mapsto g_{A} preserves the operations of addition and scalar multiplication.

Therefore, the associationA \mapsto g_{A} is an isomorphism between the space of m x n matrices with coefficients in K and the space of bilinear forms in Km x K​​​​​​​n.

Learn more about AssociationA

brainly.com/question/30760302

#SPJ11

Helppppp What is the volume of this figure

Answers

The volume of the figure is 144 cubic inches.

What is the volume of an object?

The volume of an object is the three dimensional space that it fills up. Since there are different shapes, thus their volume can be expressed with different equations.

In the given shape, divide it into two cuboid so that;

volume of a cuboid = length*width*height

volume of cuboid 1 = 12 * 2* 4

                               = 96

volume of cuboid 1 is 96 cubic inches.

volume of cuboid 2 = 12*4*1

                                = 48

Volume of the figure = 96 + 48

                              = 144 cubic inches

Learn more about the volume of an object at https://brainly.com/question/12693294

#SPJ1

Determine where functions are continuous: (a) f(x)=(9x^(2)-4)/(3x-2) (b) f(x)=x2^(sinx) (c) f(x)=sin(1)/(2x) (d) f(x)={(x^(2)-1,x>3),(8,n=3),(2^(x),x<3):}

Answers

The functions are continuous at all points except where the denominator of a fraction is equal to zero. This is because division by zero is undefined and causes a discontinuity in the function.

(a) f(x)=(9x^(2)-4)/(3x-2): This function is continuous everywhere except where 3x-2=0, which is when x=2/3. Therefore, the function is continuous at all points except x=2/3.

(b) f(x)=x2^(sinx): This function is continuous everywhere because there are no denominators that could equal zero.

(c) f(x)=sin(1)/(2x): This function is continuous everywhere except where 2x=0, which is when x=0. Therefore, the function is continuous at all points except x=0.

(d) f(x)={(x^(2)-1,x>3),(8,n=3),(2^(x),x<3):} This function is continuous for x>3 and x<3, but there is a discontinuity at x=3 because the function is not defined for x=3. Therefore, the function is continuous at all points except x=3.

In conclusion, the functions are continuous at all points except where the denominator of a fraction is equal to zero, causing a discontinuity. The functions are continuous at all other points.

Learn more about

brainly.com/question/24898810

#SPJ11

The continuity of a function can be determined by examining the values of the function at different points in its domain. If the function is continuous at a point, it means that the limit of the function as it approaches that point from both the left and the right is equal to the value of the function at that point. A function is continuous over an interval if it is continuous at every point in that interval.

(a) The function f(x)=(9x^(2)-4)/(3x-2) is continuous everywhere except at x = 2/3, where the denominator is equal to zero and the function is undefined.

(b) The function f(x)=x2^(sinx) is continuous everywhere. The exponential function 2^(sinx) is continuous for all values of x, and the product of two continuous functions is also continuous.

(c) The function f(x)=sin(1)/(2x) is continuous everywhere except at x = 0, where the denominator is equal to zero and the function is undefined.

(d) The function f(x)={(x^(2)-1,x>3),(8,n=3),(2^(x),x<3):} is continuous for x > 3 and x < 3, but it is not continuous at x = 3, where there is a jump discontinuity from 8 to 2^(3).

In conclusion, the functions are continuous at the following points:
(a) f(x)=(9x^(2)-4)/(3x-2): continuous everywhere except at x = 2/3
(b) f(x)=x2^(sinx): continuous everywhere
(c) f(x)=sin(1)/(2x): continuous everywhere except at x = 0
(d) f(x)={(x^(2)-1,x>3),(8,n=3),(2^(x),x<3):}: continuous for x > 3 and x < 3, but not continuous at x = 3

To know more about continuous function follow

brainly.com/question/18102431

#SPJ11

Find f ∘ g, g ∘ f, and g ∘ g.
f(x) = x4, g(x) = 1/x
(a)
f ∘ g
(b)
g ∘ f
(c)
g ∘ g

Answers


Hello there! To find f ∘ g, g ∘ f, and g ∘ g, let's first recall the definition of function composition: given two functions f and g, their composition f ∘ g is defined as the function that results from applying g to the result of applying f to its argument. Specifically, for a given input x, we can express the composition f ∘ g as follows: (f ∘ g)(x) = f(g(x)).

Given f(x) = x4 and g(x) = 1/x, we can find each composition as follows:

(a) f ∘ g = f(g(x)) = f(1/x) = (1/x)4

(b) g ∘ f = g(f(x)) = g(x4) = 1/(x4)

(c) g ∘ g = g(g(x)) = g(1/x) = 1/(1/x) = x

Learn more about composition

brainly.com/question/13253422

#SPJ11

6. Given a right triangle with leg lengths 19 inches and 17 inches, find the length of the
hypotenuse. Round to the nearest tenths.

Answers

In response to the supplied query, we may state that Therefore, the Pythagorean theorem length of the hypotenuse is approximately 25.5 inches.

what is Pythagorean theorem?

The Pythagorean Theorem, often known as the Pythagorean Theorem, is the fundamental Euclidean geometry relationship between the three sides of a right triangle. The area of a square with the hypotenuse side equals the sum of the areas of squares with the other two sides, according to this rule. The Pythagorean Theorem says that the square that spans a right triangle's hypotenuse opposite the right angle equals the sum of the squares that span its sides. It is sometimes written as the general algebraic notation a2 + b2 = c2.  

The Pythagorean theorem may be used to calculate the hypotenuse's length. According to the Pythagorean theorem, the square of the length of the hypotenuse (c) in a right triangle equals the sum of the squares of the lengths of the legs (a and b):

[tex]c^2 = a^2 + b^2[/tex]

[tex]c^2 = 19^2 + 17^2\\c^2 = 361 + 289\\c^2 = 650\\c =\sqrt(650)\\c = 25.5\\c = 25.5 inches[/tex]

Therefore, the length of the hypotenuse is approximately 25.5 inches.

To know more about Pythagorean theorem visit:

https://brainly.com/question/14930619

#SPJ1

Order the numbers from least to greatest

Answers

Step-by-step explanation:

-10, -8, 0, 7 is the answer

The answer should be:

-10, -8, 0, 7

Which of the following equations represents a linear function?

x = 3
y equals one half times x minus 5
y equals three fourths times x squared
3x − 6 = 4

Answers

Answer:

The equation that represents a linear function is:

y equals one half times x minus 5

This is a linear equation because it has a constant rate of change, or slope, of one half. This means that for every increase of 1 in x, y will increase by 1/2. The equation is also in the standard form of a linear equation, y = mx + b, where m is the slope and b is the y-intercept.

The other equations are not linear functions:

x = 3 is a vertical line, which is not a function because it fails the vertical line test.

y equals three fourths times x squared is a quadratic function because it includes an x-squared term.

3x − 6 = 4 is a linear equation, but it is not in the standard form of y = mx + b. It can be rearranged to y = (3/1)x - 2, which is a linear equation in slope-intercept form.

Tanner is spray painting an arrow on the side of a building to point to the entrance of his store. The can of gold spray paint he wants to use covers up to 12 square feet. Does Tanner have enough spray paint for his arrow?

Answers

Yes, Tanner has enough spray paint for his arrow.

What is an Area?

The amount of space occupied by a flat (2-D) surface or an object's shape is known as its area. A planar figure's area is the area that its perimeter encloses. The quantity of unit squares that completely encircle the surface of a closed figure is its area. Square measurements for area include cm2 and m2.

Given : paint available in can = 12 ft²

We know that the arrow is comprised of a triangle and a rectangle.

So, the area of given arrow = area of rectangle + area of triangle

Now, area of triangle = 1/2 ×base × height

                                    = 1/2 × 3 × (6 - 5 1/3)

                                    = 3/2 × ( 6 - 16/3)

                                    = 3/2 × ( 18-16)/3

                                    = 3/2 × 2/3

                                    = 1 ft²

Similarly, area of rectangle =  length × breadth

                                             = 5 1/3 × 2

                                             = 16/3 × 2

                                             = 32/3 ft²

Hence, area of arrow = area of triangle +area of rectangle

                                    = 1 + 32/3

                                    = 35/3 ft²

                                    = 11.67 ft²

So, he has sufficient paint to cover the arrow.

To learn more about Areas, visit the link:

https://brainly.com/question/2607596

#SPJ1

I need help doing the math homework

Answers

By algebra properties, the factor form of polynomials are listed below:

(a + b) · (a - b) (a + b) · (a² - a · b + b²) (a - b) · (a² + a · b + b²) (x² + 6) · (x + √6) · (x - √6) (4 · c + 1) · (16 · c² - 4 · c + 1) (k - 3) · (k² + 3 · k + 9) (∛54 · x + ∛250 · y) · [(∛54 · x)² - (∛54 · x) · (∛250 · y) + (∛250 · y)²] 3 · (m - 2 · √n) · (m + 2 · √n) · (m² + 4 · n) a · b² · (a + 1) · (a² - a + 1) · (a - 1) · (a² + a + 1) y² · (x - 7 · y) · (x² + 7 · x · y + 49 · y²) 9 · y · (y - ∛4) · [y² + ∛4 · y + (∛4)²] · (y + ∛4) · [y² - ∛4 · y + (∛4)²] (w - 4) · (w - 9) p · (p + 12) · (p - 7)

How to factor polynomials

In this problem we need to factor 13 cases of polynomials, whose results must be derived by algebra properties. The factor form of the polynomial is:

Case 1:

a² - b²

(a + b) · (a - b)

Case 2:

a³ + b³

(a + b) · (a² - a · b + b²)

Case 3:

a³ - b³

(a - b) · (a² + a · b + b²)

Case 4:

x⁴ - 36

(x² + 6) · (x² - 6)

(x² + 6) · (x + √6) · (x - √6)

Case 5:

64 · c³ + 1

(4 · c + 1) · (16 · c² - 4 · c + 1)

Case 6:

k³ - 27

(k - 3) · (k² + 3 · k + 9)

Case 7:

54 · x³ + 250 · y³

(∛54 · x + ∛250 · y) · [(∛54 · x)² - (∛54 · x) · (∛250 · y) + (∛250 · y)²]

Case 8:

3 · m⁴ - 48 · n²

(√3 · m² - 4√3 · n) · (√3 · m² + 4√3 · n)

3 · (m² - 4 · n) · (m² + 4 · n)

3 · (m - 2 · √n) · (m + 2 · √n) · (m² + 4 · n)

Case 9:

a⁷ · b² - a · b²

a · b² · (a⁶ - 1)

a · b² · (a³ + 1) · (a³ - 1)

a · b² · (a + 1) · (a² - a + 1) · (a - 1) · (a² + a + 1)

Case 10:

x³ · y² - 343 · y⁵

y² · (x³ - 343 · y³)

y² · (x - 7 · y) · (x² + 7 · x · y + 49 · y²)

Case 11:

9 · y⁷ - 144 · y

y · (9 · y⁶ - 144)

y · (3 · y³ - 12) · (3 · y³ + 12)

9 · y · (y³ - 4) · (y³ + 4)

9 · y · (y - ∛4) · [y² + ∛4 · y + (∛4)²] · (y + ∛4) · [y² - ∛4 · y + (∛4)²]

Case 12:

w² - 13 · w + 36

(w - 4) · (w - 9)

Case 13:

p³ + 5 · p² - 84 · p

p · (p² + 5 · p - 84)

p · (p + 12) · (p - 7)

To learn more on polynomials: https://brainly.com/question/15465256

#SPJ1

solve pls

3x+5y=15
x+y=3

Answers

Answer:

Solve for the first variable in one of the equations, then substitute the result into the other equation.

Point Form:

(

0

,

3

)

Equation Form:

x

=

0

,

y

=

3

Step-by-step explanation:

Answer:

x=0 y=3

Step-by-step explanation:

3(0) + 5(3) = 15

0 + 15 = 15

15=15

For the following situation, do the following but do not solve.
1. Define variables x and y.
2. Give a complete list of constraint inequalities.
3. Give a target (objective) equation (concerning profit).
Suppose a coffee company makes two blends, Columbian Supreme and Columbian Treat. Columbian Supreme takes 12 ounces of premium beans and 4 ounces of bargain beans per bag of coffee. Columbian Treat takes 7 ounces of premium beans and 9 ounces of bargain beans per bag of coffee. Suppose that 1600 ounces of premium beans and 800 ounces of bargain beans are available. If the company profits $4 per pound of Columbian Supreme and $3.25 per pound of Columbian Treat, then how can they maximize their profit? What is the maximum profit?

Answers

equation is 4x + 3.25y

To maximize their profit, the coffee company needs to define the variables x and y, which represent the number of pounds of Columbian Supreme and Columbian Treat respectively. Then, the complete list of constraint inequalities can be written as:




 x + y ≤ 400  (since 400 pounds is the total amount of both blends)
 12x + 7y ≤ 1600 (since 1600 ounces of premium beans are available)
 4x + 9y ≤ 800 (since 800 ounces of bargain beans are available)



Finally, the target (objective) equation is 4x + 3.25y, which represents the total profit from selling x pounds of Columbian Supreme and y pounds of Columbian Treat.

Learn more about Columbian Treat

brainly.com/question/27069010

#SPJ11

Read and interpret the following conditions imposed on the variables \( a, b, c, d \), and \( x \). Determine and state whether the statements in Exercises 1 - 12 are true or false. If they are false,

Answers

The given conditions imposed on the variables \( a, b, c, d \) and \( x \) are:

\( a+b = c \) \( d = a^2 + b^2 \) \( x = a^3 + b^3 \)



To determine if the statements in Exercises 1-12 are true or false, use the given conditions to evaluate the expressions in the statement. If the statement matches the conditions, it is true; if it does not, it is false. For example, if the statement is: " \( a + b = d \) ", then this is false, as \( a + b \neq d \).

Learn more about variables

brainly.com/question/17344045

#SPJ11

HELLOOOO PLEASE HELP ME 15 POINTS!!!!!

Answers

Answer: C

Step-by-step explanation: Just replace x=1,2,3,4 to see which answers satisfy the given conditions

Kaleigh binge-watched her favorite 30-minute episodes. Which representation does NOT show the amount of time Kaleigh spent watching TV at this rate?
x
x
A
C
Time (minutes)
4x D
Time Spent Watching TV
180
150
120
90
60
30
0
B y = 30x, where x represents the number of episodes watched and y represents the amount of time in minutes.
2468
Number of Episodes
Kaleigh spent 180 minutes watching 4 episodes.
Time Spent Watching TV
Episodes, x
2
4
6
8
Time (minutes), y
60
120
180
240

Answers

Answer:

Representation B does not show the amount of time Kaleigh spent watching TV at this rate. Representation B only shows the total time she would have spent based on the number of episodes watched, assuming each episode is 30 minutes long. It does not take into account the actual time it took for Kaleigh to watch the episodes, which may have varied depending on how quickly she watched them.

Step-by-step explanation:

QUICK
HELP ME PLS
I NEED ERGENT HELP

Answers

Answer:

Step-by-step explanation:

For any cube the total edge length is equal to 12n, with n being the length of an edge side. Knowing this:

Cube A - Total edge length = 12(3) or 36

Cube B - 12(5) or 60

Cube C - 12(9.5) or 114

If any cube has edge length s, the total edge length is 12s

Hope this helps!

"Define T : R 2 → R 2 by T(~x) = T x1 x2 = 3x1 − 2x2 2x2 a) Let
~u = u1 u2 and ~v = v1 v2 be two vectors in R 2 and let c be any
scalar. Prove that T is a linear transformation. 2 b) Find the
stand"ard matrix A of T. Answer: c) Is T one-to-one? Prove your answer using the matrix A.

Answers

To prove that T is a linear transformation, we need to show that T(c~u + ~v) = cT(~u) + T(~v) for any scalar c and any vectors ~u and ~v in R2.

Let ~u = (u1, u2) and ~v = (v1, v2) be two vectors in R2 and let c be any scalar. Then,

T(c~u + ~v) = T(cu1 + v1, cu2 + v2) = (3(cu1 + v1) - 2(cu2 + v2), 2(cu2 + v2))

= (3cu1 + 3v1 - 2cu2 - 2v2, 2cu2 + 2v2)

= (3cu1 - 2cu2, 2cu2) + (3v1 - 2v2, 2v2)

= c(3u1 - 2u2, 2u2) + (3v1 - 2v2, 2v2)

= cT(~u) + T(~v)

Therefore, T is a linear transformation.

To find the standard matrix A of T, we can use the fact that T(~e1) and T(~e2) are the first and second columns of A, respectively, where ~e1 = (1, 0) and ~e2 = (0, 1) are the standard basis vectors of R2.

T(~e1) = T(1, 0) = (3(1) - 2(0), 2(0)) = (3, 0)

T(~e2) = T(0, 1) = (3(0) - 2(1), 2(1)) = (-2, 2)

Therefore, the standard matrix A of T is:

A = [ 3  -2 ]
     [ 0   2 ]

To determine if T is one-to-one, we can use the fact that a linear transformation is one-to-one if and only if its standard matrix A has linearly independent columns. In this case, the columns of A are linearly independent because they are not scalar multiples of each other. Therefore, T is one-to-one. Alternatively, we can use the fact that a linear transformation is one-to-one if and only if its standard matrix A has a nonzero determinant. In this case, the determinant of A is (3)(2) - (0)(-2) = 6, which is nonzero. Therefore, T is one-to-one.

Know more about linear transformation here:

https://brainly.com/question/30585642

#SPJ11

The mean earnings of a university undergraduate student is enrolled in a Business program is $28,000 per year. Assume that the average salaries follow a normal distribution with a standard deviation of $2,500.
Required
a. Find the probabilities that a student makes more than $30,000?
b. What is the probability that a student would make between $27,000 and $32,000?
c. What is the probability that a student would make less than $23,150?

Answers

a. The probability that a student makes more than $30,000 is 0.0668.

b. The probability that a student makes between $27,000 and $32,000 is 0.9545.

c. The probability that a student makes less than $23,150 is 0.0062.

Probability is the likelihood that something will occur. When we don't know how an occurrence will turn out, we can discuss the likelihood or likelihood of various events. Statistics is the study of occurrences that follow a chance distribution.

For more such questions on Probability, visit:

brainly.com/question/30034780

#SPJ11

Simplify each expression by performing the indici (a) z+3z; (b) z*3z; (c) -z-3z; (d) (-z)(-3z) (a) z+3z=1

Answers

The simplified expressions are: (a) z = 1/4, (b) 3z^2, (c) -4z, and (d) 3z^2.

To simplify each expression by performing the indici, we need to follow the order of operations and combine like terms. Here are the steps for each expression:

(a) z + 3z = 1
First, we need to combine the like terms on the left side of the equation. Since both terms have the variable z, we can add them together:
4z = 1
Next, we need to solve for z by isolating the variable on one side of the equation. We can do this by dividing both sides of the equation by 4:
z = 1/4

(b) z * 3z
To simplify this expression, we just need to multiply the two terms together:
3z^2

(c) -z - 3z
To simplify this expression, we need to combine the like terms. Since both terms have the variable z, we can add them together:
-4z

(d) (-z)(-3z)
To simplify this expression, we just need to multiply the two terms together. Remember that a negative times a negative is a positive:
3z^2

So the simplified expressions are: (a) z = 1/4, (b) 3z^2, (c) -4z, and (d) 3z^2.

Learn more about indici

brainly.com/question/29071716

#SPJ11

PLEASE HELP!!!

Tanner is spray painting an arrow on the side of a building to point to the entrance of his store. The can of gold spray paint he wants to use covers up to 12 square feet. Does Tanner have enough spray paint for his arrow?

Answers

Yes, Tanner has enough spray paint for his arrow.

What is an Area?

The amount of space occupied by a flat (2-D) surface or an object's shape is known as its area. A planar figure's area is the area that its perimeter encloses. The quantity of unit squares that completely encircle the surface of a closed figure is its area. Square measurements for area include cm2 and m2.

Given : paint available in can = 12 ft²

We know that the arrow is comprised of a triangle and a rectangle.

So, the area of given arrow = area of rectangle + area of triangle

Now, area of triangle = 1/2 ×base × height

                                   = 1/2 × 3 × (6 - 5 1/3)

                                   = 3/2 × ( 6 - 16/3)

                                   = 3/2 × ( 18-16)/3

                                   = 3/2 × 2/3

                                    = 1 ft²

Similarly, area of rectangle =  length × breadth

                                            = 5 1/3 × 2

                                            = 16/3 × 2

                                            = 32/3 ft²

Hence, area of arrow = area of triangle +area of rectangle

                                   = 1 + 32/3

                                   = 35/3 ft²

                                   = 11.67 ft²

So, he has sufficient paint to cover the arrow.

To learn more about Areas, visit the link:

brainly.com/question/2607596

#SPJ1

Graph Y=2x on this chart thanks

Answers

Answer:

Step-by-step explanation:

The slope is 2 so rise / run = 2 / 1, or up two right one.

How much of a 40% antifreeze solution must a mechanic mix with an 80% antifreeze solution if 16 gallons of a 50% antifreeze solution are needed?

Answers

The mechanic must mix 12 gallons of a 40% antifreeze solution with 4 gallons of an 80% antifreeze solution to create 16 gallons of a 50% antifreeze solution.

To find out how much of a 40% antifreeze solution must be mixed with an 80% antifreeze solution to create 16 gallons of a 50% antifreeze solution, we can use the following equation:

40% x + 80% y = 50% (16)

Where x is the amount of 40% antifreeze solution and y is the amount of 80% antifreeze solution.

We can also use the fact that the total amount of solution must equal 16 gallons:

x + y = 16

Now we can solve for one variable in terms of the other. Let's solve for x in the second equation:

x = 16 - y

And substitute this value of x into the first equation:

40% (16 - y) + 80% y = 50% (16)

Simplifying:

[tex]6.4 - 0.4y + 0.8y = 8[/tex]

0.4y = 1.6

y = 4

Now we can substitute this value of y back into the equation for x:

x = 16 - 4

x = 12

To learn more about antifreeze solution here:

https://brainly.com/question/28057522#

#SPJ11

1. Let the point \( P \) be \( (-1,3) \) and the point \( Q \) be \( (3,7) \). Find the following. a. \( \mathbf{v}=\overrightarrow{P Q} \) b. \( \|\mathbf{v}\| \) c. \( \overrightarrow{P Q}+\overrigh

Answers

The answers are:
a. \( \mathbf{v}=\overrightarrow{P Q} = (4, 4) \)
b. \( \|\mathbf{v}\| = 4\sqrt{2} \)
c. \( \overrightarrow{P Q}+\overrightarrow{Q P} = (0, 0) \)

The given points are point \( P \) be \( (-1,3) \) and point \( Q \) be \( (3,7) \).

a. To find \( \mathbf{v}=\overrightarrow{P Q} \), we subtract the coordinates of point \( P \) from the coordinates of point \( Q \):

\( \mathbf{v}=\overrightarrow{P Q} = (3-(-1), 7-3) = (4, 4) \)

b. To find \( \|\mathbf{v}\| \), we use the distance formula:

\( \|\mathbf{v}\| = \sqrt{(4-0)^2 + (4-0)^2} = \sqrt{16 + 16} = \sqrt{32} = 4\sqrt{2} \)

c. To find \( \overrightarrow{P Q}+\overrightarrow{Q P} \), we add the coordinates of \( \overrightarrow{P Q} \) and \( \overrightarrow{Q P} \):

\( \overrightarrow{P Q}+\overrightarrow{Q P} = (4, 4) + (-4, -4) = (0, 0) \)

Therefore, the answers are:

a. \( \mathbf{v}=\overrightarrow{P Q} = (4, 4) \)

b. \( \|\mathbf{v}\| = 4\sqrt{2} \)

c. \( \overrightarrow{P Q}+\overrightarrow{Q P} = (0, 0) \)

Learn more about distance formula

brainly.com/question/25841655

#SPJ11

Find the area of the trapezoid.

Answers

Answer:

area = (1/2) · (p + q) · h

Step-by-step explanation:

The average salary of 36 employee was 4650. Using historical data, we will assume that the population standard deviation is 165. Find the 98% confidence interval for the population mean salary.
Select one:
a. 4650±63.97
b. 4650±67.05
c. 4650±70.84
d. 4650±45.24
e. 4650±74.91
f. 4650±53.90
g. 4650±46.48
h. 4650±55.83

Answers

The average salary of 36 employee was 4650. Using historical data, we will assume that the population standard deviation is 165. The 98% confidence interval for the population mean salary is 4650±70.84. The correct answer is option c. 4650±70.84.

To find the 98% confidence interval for the population mean salary, we will use the formula:

CI = X ± Z* (σ/√n)

Where:
CI = Confidence Interval
X = Sample mean
Z = Z-score for the given confidence level
σ = Population standard deviation
n = Sample size

Plugging in the given values, we get:

CI = 4650 ± 2.33* (165/√36)

CI = 4650 ± 70.84

Therefore, the 98% confidence interval for the population mean salary is 4650±70.84. The correct answer is C.

Learn me about confidence interval here: brainly.com/question/17097944.

#SPJ11

PLEASE HELP :((( show BOTH distribution and FOIL to find the product of (3x - 2)and(2z + 6).

Answers

According to the given information product of (3x - 2) and (2z + 6) is 6xz + 18x - 4z - 12.

What is expression ?

In mathematics, expressions are also combinations of constants, variables, operators, and function calls that represent mathematical operations or relationships.

According to given conditions:

Let's start with distributing the first term of the first expression to both terms of the second expression, then distributing the second term of the first expression to both terms of the second expression:

(3x - 2)(2z + 6)

= 3x(2z + 6) - 2(2z + 6)

= 6xz + 18x - 4z - 12

Now, let's use the FOIL method to find the same product:

(3x - 2)(2z + 6)

= 3x(2z) + 3x(6) - 2(2z) - 2(6)

= 6xz + 18x - 4z - 12

As you can see, both methods result in the same product: 6xz + 18x - 4z - 12.

Therefore, according to the given information product of (3x - 2) and (2z + 6) is 6xz + 18x - 4z - 12.


To know more about expressions visit :

brainly.com/question/1859113

#SPJ1

What was Mika's estimate and what is the actual sum of the numbers? (Look at the picture below)

Answers

Mika's estimate was 216 and the actual sum of the numbers is 216.27. The solution has been obtained by using the arithmetic operations.

What are arithmetic operations?

All real numbers are supposed to be explicable by the four fundamental operations, often known as "arithmetic operations". Quotient, product, sum, and difference are the four operations in mathematics that follow division, multiplication, addition, and subtraction.

We are given numbers as 189.27, 15.8 and 11.2.

Mika's estimate is as follows:

189 + 16 + 11 = 216

Actual sum of numbers is as follows:

189.27 + 15.8 + 11.2 = 216.27

Hence, Mika's estimate was 216 and the actual sum of the numbers is 216.27.

Learn more about arithmetic operations from the given link

https://brainly.com/question/30283549

#SPJ1

i need help with this answer

Answers

Ummm what is the question?

Jamal works as an electrician’s apprentice. He rewired 4 electrical outlets in 1 and one-halfhours. If he works at the same pace for 7.5 hours, how many outlets will he rewire?

Answers

Answer:

Below

Step-by-step explanation:

4 outlets/ 1.5 hr     *    7.5 hr = 20 outlets   ( see how 'hr' cancels out and you are left with 'outlets ?)

Answer: 20

Step-by-step explanation:

In 1.5 hours, the no. of electrical outlets rewired = 4

Then, in 1 hour the no. of electrical outlets rewired = 4/1.5

So, in 7.5 hours the no. of electrical outlets rewired =( 4/1.5 ) × 7.5 = 20.

in the whitch of blackbird pond chapters 13-15 what causes several townsmen to gather at the wood household until late at night

Answers

Answer:

In the novel "The Witch of Blackbird Pond" by Elizabeth George Speare, in chapters 13-15, several townsmen gather at the Wood household until late at night because they suspect that Kit's grandfather, Matthew Wood, is hiding royalist sympathies. The men search through Matthew's belongings and find books and pamphlets that are considered to be treasonous, including a pamphlet by William Penn. They also find a prayer book that Matthew had brought with him from England. The men take the items and leave, warning the Woods to be careful about their political leanings. This event foreshadows the tension and conflict that will arise later in the novel between the royalists and the patriots.

Step-by-step explanation:

cuz graaa thag boys a lier da boys a lier

Luis wants to buy a skateboard that usually sells for $79.28. All merchandise is discounted by 12%. What is the total cost of the skateboard If Luis has to pay a state sales tax of 8.25%. Round your intermediate calculations and answer to the nearest cent.​

Answers

Answer:

The discount on the skateboard is 12% of its original price, so the discounted price is:

Discounted price = $79.28 - 0.12($79.28) = $69.78

Now we need to calculate the sales tax on the discounted price. The sales tax rate is 8.25%, so the amount of sales tax is:

Sales tax = 0.0825($69.78) = $5.76

Adding the discounted price and the sales tax, we get the total cost of the skateboard:

Total cost = $69.78 + $5.76 = $75.54

Therefore, the total cost of the skateboard, including the discount and sales tax, is $75.54.

Other Questions
5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math. Q: In the case of Pakistans economy, write down in your own words the implications of following two situations on the parameters (such as depreciation, population growth, productivity, saving rate) of the Solow Model.a. Situation 1: Extreme wave of Covid-19 leading towards mobility restrictions.b. Situation 2: Russian attack on Ukraine lead to more uncertainty. The company believes it will be able to hire a qualified individual for a $95,000.00 annual salary. The company pays $150.00 of each employees $400.00 monthly insurance premium. Determine the total annual salary and payroll tax expense for the employee, assuming the company does not have an IRS-approved health care plan.