A charity needs to report its typical donations received. The following is a list of the donations from one week. A histogram is provided to display the data.

10, 11, 35, 39, 40, 42, 42, 45, 49, 49, 51, 51, 52, 53, 53, 54, 56, 59

A graph titled Donations to Charity in Dollars. The x-axis is labeled 10 to 19, 20 to 29, 30 to 39, 40 to 49, and 50 to 59. The y-axis is labeled Frequency. There is a shaded bar up to 2 above 10 to 19, up to 2 above 30 to 39, up to 6 above 40 to 49, and up to 8 above 50 to 59. There is no shaded bar above 20 to 29.

Which measure of variability should the charity use to accurately represent the data? Explain your answer.

The range of 13 is the most accurate to use, since the data is skewed.
The IQR of 49 is the most accurate to use to show that they need more money.
The range of 49 is the most accurate to use to show that they have plenty of money.
The IQR of 13 is the most accurate to use, since the data is skewed.

Answers

Answer 1

Answer:

The IQR (interquartile range) of 13 is the most accurate measure of variability to use in this case, since the data is skewed and contains some outliers.

The IQR is a measure of variability that is less sensitive to extreme values than the range, and is calculated as the difference between the upper and lower quartiles (the 75th and 25th percentiles). It provides a measure of the spread of the middle 50% of the data, which is useful for understanding the typical range of donations received.

In this case, the IQR is calculated as follows:

- The median of the data is 51 (the value in the middle).

- The lower quartile (Q1) is the median of the lower half of the data, which is 42.

- The upper quartile (Q3) is the median of the upper half of the data, which is 54.

- The IQR is the difference between Q3 and Q1: IQR = Q3 - Q1 = 54 - 42 = 12.

So the IQR of 13 is a useful measure of variability to use for this data set, since it captures the spread of the middle 50% of the data while being less sensitive to the outliers at the higher end of the distribution.


Related Questions

Find the lateral and total surface area round to the nearest hundredth if necessary

Answers

The lateral and total surface area of the prism are 1000 square feet and 1120 square feet.

How to determine the lateral and total surface area of a prism

In this problem we need to determine the lateral and total surface area of a prism with a triangular base. The lateral surface area is the sum of the areas of the three rectangles and the total surface area is the sum of the lateral surface area and the areas of the two triangles.

The area formulas for the triangle and the rectangle are, respectively:

Triangle:

A = s · √[s · (s - a) · (s - b) · (s - c)]

s = 0.5 · (a + b + c)

Where:

a, b, c - Sides, in feet.s - Semiperimeter, in feet.A - Area, in square feet.

Rectangle:

A = w · h

Where:

w - Width, in feeth - Height, in feet.A - Area, in square feet.

Now we proceed to determine each surface area:

Lateral surface area:

A = 2 · (20 ft) · (17 ft) + (20 ft) · (16 ft)

A = 1000 ft²

Total surface area:

s = 0.5 · (17 ft + 17 ft + 16 ft)

s = 25 ft

A = √[(25 ft) · (25 ft - 17 ft)² · (25 ft - 16 ft)] + 1000 ft²

A = 1120 ft²

To learn more on surface area: https://brainly.com/question/29298005

#SPJ1

Hurry I’m running out of time helpppppp


Trey's company makes solid balls out of scrap metal for various industrial uses. For one project, he must make aluminum balls that have a radius of 7.5 in. If
aluminum costs $0.12 per in, how much will the aluminum cost to make one ball?
Use 3.14 for x, and do not round your answer.

Answers

Thus, Cost of making 1  solid aluminium ball is found as  $211.95.

Explain about the spherical shape:

Something spherical is similar to a sphere in three dimensions in that it is round, or somewhat round. Even though they are never exactly round, oranges and apples are both spherical. Since an asteroid is frequently spheroidal—nearly round but lumpy—it has an approximately spherical form.

radius of solid aluminium balls r = 7.5 in.

Cost of of aluminium = $0.12 per cu. in.

Volume of sphere = 4/3 * π * r³

Volume of sphere = 4/3 * 3.14 * 7.5³

Volume of sphere = 1766.25 cu. in.

Cost of making 1  solid aluminium ball = 0.12 * 1766.25

Cost of making 1  solid aluminium ball = $211.95.

Thus, Cost of making 1  solid aluminium ball is found as  $211.95.

Know more about the spherical shape:

https://brainly.com/question/10171109

#SPJ1

Find the probability that
event A or B takes place.

Answers

The probability that event A or B takes place is P ( A ∪ B ) = 6/17

Given data ,

Let the probability that event A or B takes place is P ( A ∪ B )

Now , the probability of A is P ( A ) = 2/17

And , the probability of B is P ( B ) = 4/17

where P ( A ∩ B ) = 0

On simplifying the equation , we get

P ( A ∪ B ) = P ( A ) + P ( B ) - P ( A ∩ B )

So , P ( A ∪ B ) = 2/17 + 4/17

P ( A ∪ B ) = 6/17

Hence , the probability is 6/17

To learn more about probability click :

https://brainly.com/question/17089724

#SPJ1

Write an equation that can be used to determine the angle measure, in degrees, of angle DBC. Let n represent the measure of angle DBC. Then determine the measure of n

Answers

An equation that can be used to determine the angle measure, in degrees, of angle DBC is 67 + n = 90.

The measure of n is equal to 23 degrees.

What is a complementary angle?

In Mathematics and Geometry, a complementary angle refers to two (2) angles or arc whose sum is equal to 90 degrees (90°).

By substituting the given parameters into the complementary angle formula, the sum of the angles is given by the following mathematical equation;

∠ABD + ∠DBC = 90

∠ABD + n = 90

67 + n = 90.

n = 90 - 67

n = 23°

Read more on complementary angle here: brainly.com/question/17952433

#SPJ1

Missing information:

The question is incomplete and the complete question is shown in the attached picture.

An individual makes five annual deposits of $2000 in a savings account that
pays interest at a rate of 4% per year. One year after making the last deposit, the
interest rate changes to 6% per year. Five years after the last deposit, the accumulated
money is withdrawn from the account. How much is withdrawn?

could you solve this problem?

Answers

The total amount withdrawn from the account after five years is $24,927.38.

How do we calculate?

The future value of a series of annual deposits of $2000) can be calculated using the following formula:

FV = [tex]PMT x (((1 + r)^n^-^ 1) / r)[/tex]

where FV = the future value, PMT= the payment amount =  $2000 r =  the interest rate per period = 4% n =  the number of periods = 5

the interest rate and the number of periods are the same.

[tex]FV1 = $2000 x (((1 + 0.04)^5^-^ 1) / 0.04) = $11,025.52[/tex]

This is the amount that the deposits will grow to one year after the last deposit, at an interest rate of 4% per year.

We use compound interest:

FV = [tex]PV x (1 + r)^n[/tex]

we apply this formula with a present value of $11,025.52, an interest rate of 6%, and 4 periods, we get:

FV2 = [tex]$11,025.52 * (1 + 0.06)^4 = $13,901.86[/tex]

Therefore the total amount withdrawn = FV1 + FV2 = $11,025.52 + $13,901.86 = $24,927.38

Learn more about compound interest at:

https://brainly.com/question/24924853

#SPJ1

Solve for x. Round to the nearest tenth of a degree, if necessary.

Answers

The value of x it the nearest tenth of degree is 25.6°

What is trigonometric ratio?

The trigonometric functions are real functions which relate an angle of a right-angled triangle to ratios of two side lengths.

Sin(tetha) = opp/ hyp

cos( tetha) = adj/ hyp

tan( tetha) = opp/ adj

Here, the hypotenuse is 92 and adjascent to the to the angle x is 63

therefore to calculate x we use cosine function

cos x = 83/92

cos x = 0.902

x = cos^-1( 0.902)

x = 25.6° ( nearest tenth)

therefore the value of x is 25.6°

learn more about trigonometric ratio from

https://brainly.com/question/24349828

#SPJ1

Pls Help Parallelogram PQRS is shown in the coordinate plane below. What is the perimeter of parallelogram PQRS?

1) Find the missing side using the right triangle shown. 2) Then find the perimeter by adding all four sides of the parallelogram!

Answers

Note that the perimeter of the parallelogram is 42

How is this so?

recall that opposite sides of a parallelogram are congruent always

We have to to find the distance between the  points Q(6, 6 ) and R(1, -6) using the distance formula which is

d = √[(x2 - x1) ² + (y2 - y 1)²]

where d is the distance between two points with paris   (x1 , y1)

and (x2, y2).

PS = QR = √(6-1)²  + (6+6)²

    = √5² + 12²
= √(25+144

= √(169)

= 13

PQ = SR = 8

Perimeter  = 13 + 13 + 8 + 8
Perimeter = 42.

Learn more about parallelogram:
https://brainly.com/question/29147156
#SPJ1

Full Question:

Although part of your question is missing, you might be referring to this full question:

See attached image.

What is the area of one of the bases,b, of the prism b=_in2

Answers

Answer: 6

Step-by-step explanation:

Therefore, area of the base 'B' of given rectangular prism is equal to 6 in².

Answer:

Step-by-step explanation:

B= area of the triangle 1+area of triangle 2

(1/2*3*1)+(1/2*2*1)

=1.5+1

=2.5

Solve the equation for the indicated variable

X= (simplify your answer)

Answers

B = (715x) / (h^2)

Step 1: Get rid of the denominator by multiplying both sides by h^2

(B)(h^2) = 715x

Step 2: Isolate x by dividing both sides by 715

(Bh^2) / 715 = x

Answer: x = Bh^2 / 715

Hope this helps!

Transactions on Furnell's credit card are shown for the month of June. The interest rate is 1.4% per month.

June 1 Balance $352.12
June 4 Sears $331.89
June 8 eBay $81.58
June 15 Outback $30
June 18 Payment $200




Find the average daily balance $
184.89

Find the interest for the month $

Find the balance for the following month $

Answers

The interest for the month is:  $2.59

The balance for the month is: $598.18.

We have the information from the question is:

The interest rate is 1.4% per month.

June 1 Balance $352.12

June 4 Sears $331.89

June 8 eBay $81.58

June 15 Outback $30

June 18 Payment $200

Now, According to the question:

The average daily balance for June is $184.89.

To calculate the interest for the month,

Multiply the average daily balance by the interest rate:

$184.89 × 1.4% = $2.59.

To find the balance for the month :

Add the initial balance, transactions, and interest, then subtract the payment:

$352.12 + $331.89 + $81.58 + $30 + $2.59 - $200 = $598.18.

Learn more about Interest Rate at:

https://brainly.com/question/13324776

#SPJ1

A 45-year-old man puts $2500 in a retirement account at the end of each quarter until he reaches the age of 66, then makes no further deposits. If the account pays 4% interest compounded quarterly, how much will be in the account when the man retires at age 71? There will be $ in the account.

Answers

Answer: The man will make deposits for 66 - 45 = 21 years, or 21 x 4 = 84 quarters.

The quarterly interest rate is 4% / 4 = 1%.

Let's use the formula for the future value of an annuity:

FV = PMT x ((1 + r)^n - 1) / r

where FV is the future value of the annuity, PMT is the periodic payment, r is the interest rate per period, and n is the number of periods.

In this case, PMT = $2500, r = 1%, and n = 84. Substituting these values into the formula, we get:

FV = $2500 x ((1 + 0.01)^84 - 1) / 0.01

FV = $2500 x (5.409 - 1) / 0.01

FV = $2500 x 540.9

FV = $1,352,250

Therefore, there will be $1,352,250 in the account when the man retires at age 71.

Given: rectangle MNPQ ~ rectangle RSTU

- find the perimeter of rectangle RSTU
- find the area of rectangle RSTU

Answers

The perimeter of rectangle RSTU is 21 cm.

The area of the rectangle RSTU is 27 cm².

How to find the perimeter and area of a rectangle?

A rectangle is a quadrilateral that has opposite side equal to each other and opposite side parallel to each other.

Therefore, let's find the perimeter of the rectangle RSTU and the area of RSTU.

Hence,

Let's find the width of the rectangle MNPQ

14 = 2(4 + w)

14 = 8 + 2w

14 - 8 = 2w

2w = 6

w = 6 / 2

w = 3 cm

Therefore, using similar ratio,

4 / 6 = 3 / RU

cross multiply

4RU = 18

RU = 18 / 4

RU = 4.5 cm

Therefore,

Perimeter of the rectangle RSTU = 2(6 + 4.5)

Perimeter of the rectangle RSTU = 2(10.5)

Perimeter of the rectangle RSTU =21 cm

Area of the rectangle RSTU = 4.5 × 6

Area of the rectangle RSTU = 27 cm²

learn more on rectangle here: https://brainly.com/question/2286712

#SPJ1

Help please Given the diagram below, what statement could you make about the relationship between angles 1 and 4?

A) ∠1 is congruent to ∠4.
B) m∠1 is greater than m∠4.
C) m∠1 is less than m∠4.
D) ∠1 and ∠4 cannot be determined.

Answers

Answer:

A) angle 1 is congruent (equal size) to angle 4.

Step-by-step explanation:

when 2 lines intersect, then the intersection angles are the same on both sides of any of the lines. they are only left-right mirrored.

Answer:

A) angle 1 is congruent (equal size) to angle 4.

Step-by-step explanation:

pls help with this geometry asap

Answers

Area of sector XYZ is 81.45 feet².

Define area of sector

The area of a sector is a measure of the size of a portion of a circle enclosed by two radii and an arc between them. It is expressed in square units, such as square centimeters, square meters, or square inches.

To find the area of a sector, you need to know the radius of the circle and the central angle of the sector.

The formula for the area of a sector is:

Area of sector = (central angle / 360°) x π x r²

where r is the radius of the circle, π is the mathematical constant pi (approximately 3.14), and the central angle is measured in degrees.

n is the area of sector XYZ

n/360=115/255(X)

n/255=115/360(V)

(The same elements are proportional)

n=115/360×255

n=81.4583≈81.45 feet²

To know more about circle, visit:

https://brainly.com/question/29142813

#SPJ1

Malaika has a number of candies. She can give out 12 to each of her friends and have 3 left over. or she can give 9 out to each of her friends and have 12 left over. How many friends can receive candy?

Answers

If she can give out 12 to each of her friends and have 3 left over. or she can give 9 out to each of her friends and have 12 left over, Malaika has 3 friends who can receive candies.

Let's suppose Malaika has "c" candies, and "f" is the number of friends she has.

According to the problem statement, we have two equations:

c = 12f + 3

c = 9f + 12

To solve for "f", we can set the two equations equal to each other:

12f + 3 = 9f + 12

Simplifying the equation, we get:

3f = 9

Dividing both sides by 3, we get:

f = 3

We can verify our solution by plugging "f=3" back into one of the original equations:

c = 12f + 3

c = 12(3) + 3

c = 39

So, Malaika has 39 candies in total. We can also check the other equation to make sure it is true:

c = 9f + 12

c = 9(3) + 12

c = 39

Both equations are true, so our solution of "f=3" is correct.

To learn more about equation click on,

https://brainly.com/question/941655

#SPJ1

Among the products of a company, brand A has 40% of the market share. A market research firm finds that if a person uses brand A, the probability that he/she will be using it again next year is 30%. On the other hand if a person is not using the product at present, the probability that he/she will be using it next year is 60%. Required: a) Find the transition matrix. b) Find the percentage of the market share that brand A gets after two years. c) Want percentage of the market share will be handled by brand A on the long run, if the transition matrix does not change?

Answers

a) The transition matrix is  [tex]\left[\begin{array}{ccc} 0.3&0.7 \\ 0.6&0.4\end{array}\right][/tex]

b) After two years, brand A is expected to have 40.4% of the market share.

c) Brand A is expected to have 37.5% of the market share.

a) The transition matrix can be constructed using the probabilities provided in the problem. Let P be the matrix where the (i, j)-th entry represents the probability of transitioning from state i to state j. In this case, there are two states: using brand A (state 1) and not using brand A (state 2).

Using the information given in the problem, we can fill in the entries of the matrix as follows:

P = [tex]\left[\begin{array}{ccc} 0.3&0.7 \\ 0.6&0.4\end{array}\right][/tex]

b) To find the percentage of the market share that brand A gets after two years, we need to multiply the initial market share vector (40% for brand A and 60% for other brands) by the transition matrix twice:

| 0.4 0.6 | × P × P = | 0.404 0.596 |

Therefore, after two years, brand A is expected to have 40.4% of the market share.

c) To find the long-run market share for brand A, we need to find the steady-state vector of the transition matrix P. This is the vector π such that:

πP = π

and

π ₁+ π₂ = 1

where π₁ is the long-run probability of being in state 1 (using brand A) and π₂ is the long-run probability of being in state 2 (not using brand A).

Solving the equations above, we get:

π = | 0.375 0.625 |

This means that in the long run, brand A is expected to have 37.5% of the market share.

To learn more about matrix click on,

https://brainly.com/question/15071670

#SPJ1

Find the slope of the tangent to f(x)=x^2 at the point (3,9).

Answers

Answer:

f'(x) = 2x, so f'(x) = f'(3) = 2(3) = 6.

14). Find the measures of both angles.
xo
(3x +20)°

Answers

Answer:

40 degrees and 140 degrees

Step-by-step explanation:

To solve this problem you can add x+3x+20 and set that equal to 180. (We can do this because angle x and angle 3x + 20 make a linear pair. Knowing this we can estimate that both angles added together will equal 180)

Let us add x + 3x + 20 = 180 to find x. We can then substitute that into the equation.

[tex]x+3x+20=180 :a\\\\4x+20=180 :b\\\\4x + 20 -20=180-20:c\\\\4x=160:d\\\\\frac{4x}{4} = \frac{160}{4}:e\\\\x=40:f[/tex]

a: So in this part, we have rewritten the equation to make it easier to solve

b:  In this step, you combine the like terms x+3x to get 4x

c: In step c, you are subtracting 20 from both sides to keep constants on one side and variables on the right

d: In this last step the equation has been simplified to make it easier to solve.

e: To isolate x you have to divide both sides by 4, we do this because the coefficient of x is 4 so you divide the equation by 4 to cancel it out.

f: You rewrite and simplify the equation.

Now to find the measure of both angles you substitute x into the equation.

The first angle's value is 40 degrees and the second is 140 degrees.

These are our answers.

which of the following is equivalent to x-5/3?

Answers

The following expression is equivalent to [tex]x^{-5/3}[/tex] as option B that is 1/∛x⁵.

What is fraction?

A fraction is a numerical representation of a part or a portion of a whole. It is expressed as one integer (numerator) divided by another integer (denominator), separated by a horizontal line.

Here,

We can rewrite [tex]x^{-5/3}[/tex]as [tex](1/ x^{^(5/3)})[/tex].

The negative exponent in the numerator tells us that we need to move the term to the denominator of a fraction and change the sign of the exponent to make it positive. Similarly, the fractional exponent in the denominator indicates that we need to take the reciprocal of the term and change the sign of the exponent to make it positive.

Therefore, we can rewrite [tex]x^{-5/3}[/tex] as:

[tex](1/ x^{^(5/3)})[/tex]

or

[tex]x^{-5/3}[/tex] = [tex](1/ x^{^(5/3)})[/tex]

To know more about fraction,

https://brainly.com/question/24638688

#SPJ1

Complete question:

Which of the following is equivalent to [tex]x^{-5/3}[/tex]?

The graph of f(x) = a × [tex]b^x[/tex] passes through (2,54) and (5,16).

What is the value of b?

Answers

The value of b when the graph of function f(x) = a*bˣ passes through (2,54) and (5,16), is given by, b = 2/3.

Given the function of the graph is,

f(x) = a*bˣ

It is given that the graph of the function passes through the points with coordinates (2, 54) and (5, 16). So this points must satisfy the given function.

Substituting the point (2, 54) in the given function we get,

f(2) = 54

a*b² = 54 ..................... (i)

Substituting the point (5, 16) in the given function we get,

f(5) = 16

a*b⁵ = 16 ..................... (ii)

So dividing equation (ii) by equation (i) we get,

(a*b⁵)/(a*b²) = 16/54

b³ = 8/27

b³ = (2/3)³

b = 2/3

Hence the value of b is 2/3.

To know more about function here

https://brainly.com/question/25638609

#SPJ1

Can someone help me please

Answers

The matrix formed by performing the row operation 2R₁ + R₂ — R₂ on M will have a new R₂ = [ -8 -1 -3]

What is the row of a matrix

A rectangular array of numbers or mathematical objects which are arranged in rows and columns is called a matrix. Each row of a matrix is a horizontal sequence of numbers or objects that are separated by commas and enclosed within square brackets, and it represents a vector in the row space of the matrix.

performing the row operation 2R₁ + R₂ — R₂ on M, we have;

2(-3) + (-2) = -8 {row 2 column 1}

2(-1) + 1 = -1 {row 2 column 2}

2(-4) + 5 = -3 {row 2 column 3}

Therefore, the matrix formed by performing the row operation 2R₁ + R₂ — R₂ on M will have a new R₂ = [ -8 -1 -3]

Read more about matrix row here:https://brainly.com/question/1279486

#SPJ1

An airplane is heading north at an airspeed of 550 km/hr, but there is a wind blowing from the southwest at 40 km/hr.

The plane will end up flying
degrees off course

The plane's speed relative to the ground will be
km/hr

Answers

Answer: To end up due north, the pilot will need to fly the plane 3.382 degrees east of north.

Step-by-step explanation:

don't know how to explain got it form chegg

Please answer if you know this one with the steps thank you.

Answers

Step-by-step explanation:

T = 5200 = .2 ( E - 10600)

       5200 / .2 = E - 10600

            E = 5200/.2   + 10 600 = 36600 pounds

what are the answers to these questions?

Answers

The value of the points is,

(1/5, 7/5)  or (0.2, 1.4)

The given equation may be simplified as follows:

x² + 14xy + 49y² = 100

(x + 7y)(x + 7y) = 100

(x + 7y)² = 10²

x + 7y = 10

This is a straight line with the equation.

y = -(1/7)x + 10/7

The minimum distance from the origin to this line is provided by a straight line that passes through the origin and which is perpendicular to the straight line.

The slope of the perpendicular line is 7 because the product of the two slopes should be -1.

The perpendicular line is of the form

y = 7x + c.

Because the line passes through (0,0), therefore c = 0.

The line y = 7x intercepts the original line when

y = 7x = -(1/7)x + 10/7

Therefore

7x = -(1/7)x + 10/7

Multiply through by 7.

49x = -x + 10

50x = 10

x = 1/5

y = 7x = 7/5

Hence, The minimum distance is

d = √(x² + y²)

  = √[(1/5)² + (7/5)²]

  = √2

Thus, The point is (1/5, 7/5).

So, Solution are, (1/5, 7/5)  or (0.2, 1.4)

Learn more about the coordinate visit:

https://brainly.com/question/24394007

#SPJ1

Miguel is 3 years older than Katrice. In 9 years the sum of their ages will be 51. How old is Miguel now?

Answers

Let katrice age be x
x+x+3=51
2x=51-3
2x=48
x=48/2
x=24
Now x+3
=24+3
=27

Explanation
If katrice age is x then Miguel age is x+3 because she is 3 years older

A gas can hold 10 L of gas how many cans could we filled filled with 7 L of

Answers

Answer:

2 cans

Step-by-step explanation:

Guys can someone help me with these 2 problems please that's the matrix

Answers

The solution of the matrix is [tex]4G + 2F = \begin{bmatrix}32 &-20 &-32& -8 &-40 \\-24& -28 &4 &36 &8 \\16& 24 &12 &28 &20 \\-16&-12 &0 &-40 &-36\end{bmatrix}[/tex]

A matrix is a rectangular array of numbers arranged in rows and columns. The size of a matrix is given by its dimensions, which indicate the number of rows and columns in the matrix. In this question, both matrices G and F have 4 rows and 5 columns, so we say that they are 4x5 matrices.

Scalar multiplication is performed by multiplying each element of a matrix by a scalar, which is simply a number.

Now, to find the value of 4G + 2F, we need to perform scalar multiplication on each matrix and then add the results. We get:

[tex]4G = 4 * \begin{bmatrix}8 &-5 &-8& -2 &-10 \\-6& -7 &1 &9 &2 \\4& 6 &3 &7 &5 \\-4&-3 &0 &-10 & -9\end{bmatrix}\\= \begin{bmatrix}32 &-20 &-32& -8 &-40 \\-24& -28 &4 &36 &8 \\16& 24 &12 &28 &20 \\-16&-12 &0 &-40 & -36\end{bmatrix}[/tex]

[tex]2F = 2 * \begin{bmatrix}1 &8 &-2& -5 &9 \\-9& 10 &6 &-3 &0 \\4& 5 &-4 &3 &7 \\2&-10 &-6 &-1 & -8\end{bmatrix}= \begin{bmatrix}2 &16 &-4& -10 &18 \\-18& 20 &12 &-6 &0\\8& 10 &-8 &6 &14 \\4&-20 &-12 &-2 & -16\end{bmatrix}[/tex]

Now, we can perform matrix addition on 4G and 2F to get:

[tex]4G + 2F = \begin{bmatrix}32 &-20 &-32& -8 &-40 \\-24& -28 &4 &36 &8 \\16& 24 &12 &28 &20 \\-16&-12 &0 &-40 &-36\end{bmatrix}[/tex]

Therefore, the value of 4G + 2F is the 4x5 matrix given above.

To know more about matrix here

https://brainly.com/question/28180105

#SPJ1

Assume the random variable x is distributed with mean of 50 and a standard deviation of 7. Compute the probability.
P(x > 38)

Answers

Using the given random variable and the mean the required probability in the given situation is 0.9772.

What is probability?

A probability is a numerical representation of the likelihood or chance that a specific event will take place.

Both proportions ranging from 0 to 1 and percentages ranging from 0% to 100% can be used to describe probabilities.

= P(x>36) = P(X-μ/σ>36-50/7)

= P(Z>-14/7) Z=X-μ/σ

= P(Z>-2)

= P(Z<2)  [P(Z<z) = P(Z>-z)]

= 0.9772 by the p-value table

Therefore, using the given random variable and the mean the required probability in the given situation is 0.9772.

Know more about probability here:

https://brainly.com/question/24756209

SPJ1

Correct question:

Assume the random variable x is normally distributed with mean 50 and a standard deviation 7. Find the indicated probability. P(X>36)

Find value of X and BD
Look at picture

Answers

The measure of length of x of the parallelogram is x = 2.36 units

Given data ,

Let the parallelogram be represented as ABCD

Now , the measure of lengths of the sides are

The measure of AB = 13x - 20

The measure of CD = 2x + 6

The measure of BC = 5x + 4

Opposite sides are parallel

Opposite sides are congruent

So , AB = CD

13x - 20 = 2x + 6

Subtracting 2x on both sides , we get

11x = 26

Divide by 11 on both sides , we get

x = 2.36 units

Hence , the parallelogram is solved and x = 2.36 units

To learn more about parallelogram click :

https://brainly.com/question/23488153

#SPJ1

Which statement is true about the system x - 3y = 5 and y = x - 7?
• (8, 1) is a solution to one equation but not the other one, so it is a solution to the system.
• (8, 1) is not a solution to either equation, so it is not a solution to the system.
• (8, 1) is a solution to one equation but not the other one, so it is not a solution to the system.
• (8, 1) is a solution to both equations, so it is a solution to the system.

Answers

The solution to the given equation is ( 8 , 1 )

Given data ,

To determine whether (8, 1) is a solution to the system, we need to check whether it satisfies both equations:

x - 3y = 5: 8 - 3(1) = 5, which is true

y = x - 7: 1 = 8 - 7, which is true

Since (8, 1) satisfies both equations, it is a solution to the system. Therefore, the correct answer is:

Hence , (8, 1) is a solution to both equations, so it is a solution to the system

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ1

Other Questions
Match each Native American tribe with the language family to which it belongs. Siouan Athabaskan Uto-AztecanTanouanKiowa ApacheOsageComanche KThis passage, Managing Speech Anxiety, is from a communications textbook.Review the passage as needed.wwwA. Although speech anxiety can be cured, most individuals with this condition are not sure where to fincprofessional help and treatment.B.Speech anxiety is a multisystem response; in this state, a combination of biochemical changes arereleased into the body whenever the person is placed in a stressful situation involving communicationOC. Symptoms of speech anxiety include a rapid heartbeat, an increase in blood pressure, and an overflowof adrenaline to other parts of the body.1Next Can someone help me I'm stuck. Alexandria rolled a number cube 60 times and recorded her results in the table. What is the theoretical probability of rolling a one or two? Leave as a fraction in simplest from A spotlight is mounted on the eaves of a house 20 feet above the ground. A flower bed runs between the house and the sidewalk, so the closest the ladder can be placed to the house is 15 feet. How long a ladder is needed so that an electrician can reach the place where the light is mounted If f(x) is defined as follows, find (a) f(-3), (b) f(0), and (c) f(4).xif x < 0if x = 03x + 3 ifx>0f(x) = 0(a) f(-3)= (Simplify your answer.)THE The operating system is not presently configured to run this application. A pressure switch is used in a washing machine to control the flow of water. The water pushes on a flexible container and compresses some trapped air. When the pressure of this trapped air reacher 104 kPa, the pressure switch turns the water off. The pressure of the trapped air is given by this relationship: pressure of the trapped air - atmospheric pressure + pressure difference caused by the water. Calculate the height of water in the machine when the pressurre of the trapped air reaches to 104 kPa and the switch operates. (atmospheric pressure = 100 kPa, density of water = 1000 kg/m^3) How to find out if a solid, more specifically powdered cement, is acid or alkali? Between 1940 and 1955, the average income for a u.s. family tripled. this was likely the result of- reduced unemployment - the expansion of corporations & creation of more white-collar jobs- all of these choices are correct- more women entering the workplace A car repair shop specialises in exhaust pipe replacement. Every year it costs $34,800 to rent the shop and maintain their equipment and $50,000 to pay their employees. For every exhaust pipe replaced the repair shop charges the customer the price of the parts required plus $248 as a service charge. How many exhaust pipe replacements does the repair shop need to complete in order to break even? 4. Calculate and properly express the 2017 accounts receivable turnover ratio for OReilly Auto Parts. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)8,977,726/216,251+197,274/2 = 8,977,726/206762.5 = 43.4 times Answer: 43.4 times5. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) accounts receivable turnover ratio for AutoZone. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)10,888,676/280,733+287,680/2 = 10,888,676/284206.5 = 38.3 timesAnswer: 38.3 times6. Calculate and properly express the average collection period for each company. (6 pts)OReilly Auto Parts: 365/43.4 = 8.4 daysAutoZone: 365/38.3 = 9.5 daysAnswer: OReilly Auto Parts: 8.4 daysAutoZone: 9.5 days7. Which company has a better receivable turnover ratio and why? Explain in three complete sentences. (4 pts)8. Calculate and properly express the 2017 inventory turnover ratio of OReilly Auto Parts. (6 pts)4,257,043/3,009,800+2778,976/2 = 4,257,043/2,894,388 = 1.5 timesAnswer: 1.5 times9. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) inventory turnover ratio of AutoZone. (6 pts)5,149,056/3,882,086+3,631,916/2 = 1.4 timesAnswer: 1.4 times10. Calculate the average days to sell inventory for each company. (6 pts)OReilly Auto Parts: 365/1.5 = 243.3 daysAutoZone: 365/1.4 = 260.7 days Answer: OReilly Auto Parts: 243.3 daysAutoZone: 260.7 days11. Which company has a better inventory turnover ratio? (2 pts) Why, what does this ratio represent? Explain in a short paragraph. (4 pts)I need a answer for n 7 and 11 Which of the following examples of figurative language from the poem best supports the idea that Susan B. Anthony was ahead of her time?A.On ground hard held to the last, gaining her goal for womenB. Her life is a luminous banner bome ever ahead of her eraC. Her spirit like southern starlight at once is afar and around usD. In the mine, the mill and the mart where is bartered the bread of your children At what condition do magnesium chloride and silver nitrate react? this is due now !!!!!!!! 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenthPLEASE HURRY Determine the measure of arc cad thanks grade 9-10-11 it is either 240 or 260 Basic body color for wolves is influenced by several genes, one of which has several different alleles. Two of these alleles-white coat and black coat-display incomplete dominance. A wolf is heterozygous for these two alleles displays a gray coat. Is it possible to produce a line of pure-breeding gray wolves? Why or why not?Incomplete dominance: blended traits IreadyHow were adventure playgroundsof the 1960s different fromplaygrounds of the 1920s? If your starting salary is $50,000 and you receive a 4% increase at the end ofevery year, what is the total amount, in dollars, you will earn over the first 16years that you work?Round your answer to the nearest whole dollar, and express your answerwithout using commas.Answer hereSUBMIT