A bond with a remaining maturity of 5 years pays a coupon of 8%.If the face (par) value of the bond is £1000 and the yield onsimilar bonds is 10%, what is the duration for this bond?

Answers

Answer 1

The duration of this bond is 936.62.

The duration of a bond is the weighted average of the time periods over which the bond's cash flows are received. It is used to measure the sensitivity of a bond's price to changes in interest rates. The duration of a bond can be calculated using the following formula:

Duration = (C / (1 + Y)) + (2C / (1 + Y)^2) + ... + ((N - 1)C / (1 + Y)^(N - 1)) + (N(C + FV) / (1 + Y)^N)

Where:
C = Coupon payment
Y = Yield
N = Number of years to maturity
FV = Face value

Plugging in the given values into the formula, we get:

Duration = (80 / (1 + 0.1)) + (80 / (1 + 0.1)^2) + (80 / (1 + 0.1)^3) + (80 / (1 + 0.1)^4) + (1080 / (1 + 0.1)^5)

Duration = 72.73 + 66.12 + 60.11 + 54.65 + 683.01

Duration = 936.62

Learn more about duration here: https://brainly.com/question/28064173

#SPJ11


Related Questions

Question 2 The Numbers Behind Not-for-Profit Organizations Accounting plays an important role for a wide range of business organizations worldwide. Just as the integrity of the numbers matters for business, it matters at least as much at not-for profit organizations. Proper control and reporting help ensure that money is used the way donors intended. Donors are less inclined to give to an organization if they think the organization is subject to waste or theft. The accounting challenges of some large international not- for profits rival those of the world's largest businesses. For example, after the Haitian earthquake, the Haitian-born musician Wyclef Jean was criticized for the poor accounting controls in a relief fund that he founded. In response, he hired a new accountant and improved the transparency regarding money raised and spent.
Required:
(a) What benefits does a sound accounting system provide to a not-for-profit organization?
(b) Identified FIVE (5) ways to prevent accounting fraud. Provide an example for each suggestion. (20 marks)

Answers

A sound accounting system provides several benefits to a not-for-profit organization. These include:
- Ensuring that funds are used in accordance with donor wishes and legal requirements
- Providing accurate and timely financial information to stakeholders, including donors, board members, and the public
- Helping to prevent fraud and misuse of funds
- Facilitating decision-making and strategic planning
- Helping to maintain the organization's reputation and credibility

There are several ways to prevent accounting fraud in a not-for-profit organization. These include:
1. Segregation of duties
2. Internal controls
3. Regular audits
4. Training and education
5. Whistleblower policy

Segregation of duties involves separating responsibilities for different aspects of the accounting process, so that no one person has too much control. For example, one person should not be responsible for both receiving and disbursing funds.

Internal controls include policies and procedures to ensure that financial transactions are properly authorized, recorded, and reported. For example, requiring two signatures on checks over a certain amount can help prevent fraud.

Regular audits: Conducting regular audits can help detect and prevent fraud. This could include both internal audits by the organization's own staff, and external audits by an independent accounting firm.


Providing training and education to staff and volunteers can help prevent fraud by ensuring that everyone understands the organization's accounting policies and procedures, and the importance of following them.

Having a whistleblower policy in place can encourage staff and volunteers to report any suspected fraud or other wrongdoing. This should include protections for whistleblowers, to ensure that they are not retaliated against for coming forward.

Learn more about accounting at https://brainly.com/question/16203201

#SPJ11

a Find the mean, the median, and the mode of data set: 25.42, 18, 37, 25, 18, 40, 57, 64, 66.85.36, 92, 85, 88, 92, 67, 33, 75, 85, 48, 60, 80, 60,50 b- Find the mean, the median, and the mode of data set: 12.37, 13.33, 32.67, 12.37, 26.45 c- Find the range, variance, and the standard deviation of the following data set. 10.17, 13, 12, 15, 18, 10, 17, 14, 16:22, 22, 17,23, 12. IS, 28,10,20,35 02

Answers

a) The mean, median, and mode of the first data set are:
Mean = (25.42 + 18 + 37 + 25 + 18 + 40 + 57 + 64 + 66.85 + 36 + 92 + 85 + 88 + 92 + 67 + 33 + 75 + 85 + 48 + 60 + 80 + 60 + 50) / 23 = 52.45

Median = (48 + 50) / 2 = 49
Mode = 18, 60, 85, 92 (all appear twice)
b) The mean, median, and mode of the second data set are:
Mean = (12.37 + 13.33 + 32.67 + 12.37 + 26.45) / 5 = 19.44
Median = 13.33

Mode = 12.37 (appears twice)
c) The range, variance, and standard deviation of the third data set are:
Range = 35 - 10 = 25

Variance = [(10.17 - 16.67)^2 + (13 - 16.67)^2 + (12 - 16.67)^2 + (15 - 16.67)^2 + (18 - 16.67)^2 + (10 - 16.67)^2 + (17 - 16.67)^2 + (14 - 16.67)^2 + (16 - 16.67)^2 + (22 - 16.67)^2 + (22 - 16.67)^2 + (17 - 16.67)^2 + (23 - 16.67)^2 + (12 - 16.67)^2 + (15 - 16.67)^2 + (28 - 16.67)^2 + (10 - 16.67)^2 + (20 - 16.67)^2 + (35 - 16.67)^2] / 19 = 38.67
Standard Deviation = √38.67 = 6.22

You can read more about Standard Deviation at https://brainly.com/question/475676#:

#SPJ11

What is the approximate duration of a 5-year zero-coupon
bond?
Group of answer choices
5 years
3 years
None of these
2 years
4 years

Answers

The approximate duration of a 5-year zero-coupon bond is 5 years.

The duration of a bond measures its sensitivity to changes in interest rates, and for a zero-coupon bond, the duration is equal to its maturity. Since a 5-year zero-coupon bond has a maturity of 5 years, its duration would also be 5 years.

A zero-coupon bond is a type of bond that does not pay interest to the holder during the life of the bond. Instead, the bond is issued at a discount to its face value, and the holder receives the full face value at maturity. The duration of a zero-coupon bond is equal to its time to maturity, which means that the duration of a 5-year zero-coupon bond is 5 years.

Therefore, the correct answer is 5 years.

To know more about Bond click here:

https://brainly.com/question/15105766#

#SPJ11

Instead of talking about great power, please share with us a story of you providing ‘servant leadership’ to others. Even if you are not in a leadership role now, tell us a story of something nice you did for others.

Answers

The servant leadership style is founded on the premise that leaders put the greater good first. Leaders with this style prioritise their team and organisation. They do not prioritise their own goals. Workers who work in a servant leadership setting are more likely to feel heard.

I have recently been a mentor for a local high school student who was struggling in math. I spent time every week with them, providing guidance and moral support.

I helped them to understand difficult concepts, answer challenging questions, and ultimately improve their grades. Through my servant leadership, the student was able to improve their understanding of the subject, gain confidence in themselves, and make a successful transition into their next course.

For such more question on Leadership:

https://brainly.com/question/25996547

#SPJ11

Note section disclosures in the financial statements of a public entity that sponsors adefined benefit pension plan for its employees are not required to includeA. The components of periodic pension cost.B. The funded status of the plan.C. Reclassification adjustments of other comprehensive income for the period.D. A detailed description of the plan, including employee groups covered.Which of the following defined benefit pension plan disclosures should be made in acompany’s financial statements?I. The funded status of the plans and the amounts recognized in the balance sheetThe amount of net periodic benefit cost recognized, showing its componentsseparatelyII.III. A reconciliation of beginning and ending balances of the fair value of plan assetsA. I and II.B. I, II, and III.C. II and III.D. I only.

Answers

Following are the defined benefit pension plan disclosures that should be made in a company’s financial statements:  

"I. The funded status of the plans and the amounts recognized in the balance sheet";

II. "The amount of net periodic benefit cost recognized, showing its components separately";

III. "A reconciliation of beginning and ending balances of the fair value of plan assets"

Therefore, the correct answer is option B. I, II, and III.


A company’s financial statements should include disclosures about the funded status of the defined benefit pension plan, the amounts recognized in the balance sheet, the amount of net periodic benefit cost recognized and its components, and a reconciliation of the beginning and ending balances of the fair value of plan assets. These disclosures provide important information to investors and other users of the financial statements about the company’s pension obligations and the financial health of the plan.

Therefore, option B. I, II, and III is the correct answer.

You can learn more about financial statements at

https://brainly.com/question/26240841

#SPJ11

What is the present value of $10,000 paid at the end of each of
the next 66 years if the interest rate is 5% per year?

Answers

The present value of $10,000 paid at the end of each of the next 66 years, with an interest rate of 5% per year, is equal to approximately $1,129.66.

The present value of $10,000 paid at the end of each of the next 66 years, with an interest rate of 5% per year, can be calculated using the following formula:

Present Value = 10,000/(1+0.05)^n

Where "n" is the number of years in the future.

In this case, n = 66, and so the present value is 10,000/(1+0.05)^66.

Using a calculator, this calculation is equal to approximately $1,129.66.

The present value of a series of payments in the future is based on the concept of the time value of money. This concept states that money has a different value depending on when it is received. In this example, the value of the payments decreases each year due to the effects of interest.

The present value of the payments is based on the concept of discounting, which means that future payments are worth less than present payments. This is because future payments are worth less due to the effects of inflation. By discounting payments, the value of the payments decreases each year.

For more about present value:

https://brainly.com/question/17322936

#SPJ11

Harding Company is in the process of purchasing several large pieces of equipment from Danning Machine Corporation. Several financing alternatives have been offered by Danning: 1. Pay $1,080,000 in cash immediately. 2. Pay $411,000 immediately and the remainder in 10 annual installments of $89,000, with the first installment due in one year. 3. Make 10 annual installments of $151,000 with the first payment due immediately. 4. Make one lump-sum payment of $1,680,000 five years from date of purchase.

Required: a. Assuming that Harding can borrow funds at an 9% interest rate, determine the present value. (Use PV of $1, PVA of $1, and PVAD of $1) (Round "PV Factors" to 5 decimal places and final answers to the nearest dollar amount. ) Alternative PV

1 $

2 $

3 $

4 $ b.

Which is the best alternative for Harding? Alternative 1 Alternative 2 Alternative 3 Alternative 4

Answers

Given that it has the lowest present value, Alternative 2 is the most suitable replacement for Harding. Pay $411,000 immediately and the remainder in 10 annual installments of $89,000, with the first installment due in one year.

In economics and finance, the term "present value" (PV), sometimes known as "present discounted value" (PDV), refers to the worth of an expected income stream as of the valuation date. With the exception of periods of zero or negative interest rates, when the present value will be equal to or greater than the future value, the present value is frequently less than the future value because money can earn interest, a characteristic known as the time value of money.  Time value can be stated succinctly as "A dollar today is worth more than a dollar tomorrow".

An investor or lender is involved in the financial project will decide how to invest their funds, and one method is to use present value. Since it offers the same return as the other projects for the least amount of money spent, the project with the lowest initial investment, or present value, will be chosen.

To know more about time value of money, click here:

https://brainly.com/question/2632491

#SPJ4

Go read
the McKinsey report - Analysis of Household Savings, in Saudi
Arabia KPMG, May 2020,
And
then answer the following questions:
Distinguish between the
following using suitable local (Bahrai), Regional (GCC) or International examples:
a. Primary and secondary markets
b. Capital and money markets
c. Debt and Equity securities

Answers

The McKinsey report is a renowned and respected publication that provides insights and analysis on various business and economic issues. The report is known for its comprehensive research, data-driven approach, and strategic recommendations, making it a valuable resource for business leaders, policymakers, and academics.

After reading the McKinsey report, here are the distinctions between the different types of markets and securities:

a. Primary and secondary markets:

Primary markets are where new securities are issued and sold for the first time. For example, when a company goes public through an initial public offering (IPO), it is selling its shares on the primary market.Secondary markets are where existing securities are bought and sold. For example, when you buy or sell stocks on the Bahrain Bourse, you are trading on the secondary market.

b. Capital and money markets:

Capital markets are where long-term securities, such as stocks and bonds, are traded. These markets are important for companies looking to raise capital for growth and expansion. An example of a capital market in the GCC region is the Dubai Financial Market.Money markets are where short-term securities, such as Treasury bills and commercial paper, are traded. These markets are important for companies and governments looking to raise short-term funds. An example of a money market is the London Interbank Offered Rate (LIBOR), which is an international benchmark for short-term interest rates.
c. Debt and Equity securities:Debt securities are financial instruments that represent a loan from the investor to the issuer. These securities typically pay a fixed rate of interest and have a set maturity date. An example of a debt security is a bond issued by the Saudi Arabian government.Equity securities are financial instruments that represent ownership in a company. These securities typically do not have a set maturity date and may pay dividends to shareholders. An example of an equity security is a stock in a Bahraini company listed on the Bahrain Bourse.

To learn more about Primary markets:

https://brainly.com/question/13993804#
#SPJ11

One unit of A is composed of two units of B and three units of C. Each B is composed of one unit of F. C is made of one unit of D, one unit of E, and two units of F. Items A, B, C, and D have 20, 50, 60, and 25 units of on-hand inventory, respectively. Items A, B, and C use lot-for-lot (L4L) as their lot-sizing technique, while D, E, and F require multiples of 50, 100, and 100, respectively, to be purchased. B has schedule receipts of 30 units in Period 1. No other scheduled receipts exist. Lead times are one period for items A, B, and D, and two periods for items C, E, and F. Gross requirements for A are 20 units in Period 1, 20 units in period 2, 60 units in period 6, and 50 units in period 8. Find the planned order releases for all items.

Answers

To find the planned order releases for all items, we need to break down the information provided and solve the problem step by step.

First, calculate the net requirements for each item by subtracting the on-hand inventory from the gross requirements. The net requirements for A are 0 units in Period 1, 0 units in period 2, 60 units in period 6, and 50 units in period 8. For B, the net requirements are 20 units in Period 1 and 0 units in other periods. For C, the net requirements are 60 units in Period 1, 40 units in period 2, and 0 units in other periods. Lastly, for D, the net requirements are 0 units in Period 1 and 25 units in period 2.

Next, we need to calculate the lot sizes for each item. For A, B, and D, since they use lot-for-lot (L4L) as their lot-sizing technique, the lot size is equal to the net requirements. For C, E, and F, since they require multiples of 50, 100, and 100, respectively, to be purchased, the lot size is equal to the lowest multiple of those numbers that is greater than or equal to the net requirements. For example, the lot size for C is 100 units.

Finally, calculate the planned order releases for each item by adding the lot size to the scheduled receipts and the lead time. For A, B, and D, since they have a lead time of one period and no scheduled receipts, the planned order releases are equal to the lot size. For C, E, and F, since they have a lead time of two periods, the planned order releases are equal to the lot size plus two periods. For example, the planned order release for C is 100 units in Period 3.

To summarize, the planned order releases for each item are as follows:

A: 0 units in Period 1 and 0 units in Period 2B: 20 units in Period 1 and 0 units in other periodsC: 100 units in Period 3, 40 units in Period 4, and 0 units in other periodsD: 0 units in Period 1 and 25 units in Period 2E: 100 units in Period 3F: 100 units in Period 3 and 200 units in Period 5

Know more about planned order releases here:

https://brainly.com/question/28327756

#SPJ11

Kilmer Corporation began the year with retained earnings of $930,000. During the year, the company issued $1,260,000 of common stock, recorded expenses of $3,600,000, and paid dividends of $240,000. If Kilmer's ending retained earnings was $990,000, what was the company's revenue for the year?
a. $3,660,000
b. $3,900,000
c. $50,169,000
d. $4,920,000

Answers

The company's revenue for the year $3,900,000. The correct answer is b.

To find the company's revenue for the year, we can use the formula:

Ending Retained Earnings = Beginning Retained Earnings + Revenue - Expenses - Dividends

We can rearrange this formula to solve for revenue:

Revenue = Ending Retained Earnings - Beginning Retained Earnings + Expenses + Dividends

Plugging in the given values:

Revenue
= $990,000 - $930,000 + $3,600,000 + $240,000

Simplifying:

Revenue = $60,000 + $3,600,000 + $240,000

Revenue = $3,900,000

Therefore, the company's revenue for the year was $3,900,000. The correct answer is b.

To learn more about Revenue  here:

https://brainly.com/question/16232387#

#SPJ11

6. Assume a major investment service has just given Oasis Electronics its highest investment rating, along with a strong buy recommendation. As a result you decide to take a look yourself and to place a value on the company's stock. Here's what you find: This year, Oasis paid stockholders an annual dividend of $3 a share, but because of its high rate of growth in earnings, it dividend is expected to grow at the rate of 12 percent a year for the next four years and then to level out at 9 percent a year. So far, you have also learned that the stock has a beta of 1.80, the risk free rate of return is 6 percent, and the expected rate of return on the market is 11 percent. Using the CAPM to find the required rate of return, put a value on this stock.

Answers

The value of the stock is $36 for the first four years and $54 for the remaining years.

The required rate of return for the stock can be found using the Capital Asset Pricing Model (CAPM):
Required rate of return = Risk free rate + Beta*(Expected rate of return on the market - Risk free rate)
Plugging in the values from the question:
Required rate of return = 6% + 1.80*(11% - 6%)
Required rate of return = 6% + 1.80*5%
Required rate of return = 6% + 9%
Required rate of return = 15%


Next, we can use the Gordon Growth Model to find the value of the stock:
Value of stock = (Dividend*(1+Growth rate))/(Required rate of return - Growth rate)
For the first four years, the growth rate is 12%:
Value of stock = ($3*(1+12%))/(15% - 12%)
Value of stock = $36


For the remaining years, the growth rate is 9%:
Value of stock = ($3*(1+9%))/(15% - 9%)
Value of stock = $54
Therefore, the value of the stock is $36 for the first four years and $54 for the remaining years.

For such more question on value:

https://brainly.com/question/30815645

#SPJ11

Taxation and Fundamentals of Tax Planning (HPAC4009) 21/22 ASSIGNMENT 1
Noel is employed by Global Inc ("Global"), a consultancy company in the US as project manager since 2015. His employment contract was discussed and signed in New York and his salary is paid directly into his bank account in New York. In April 2020, he was assigned to Hong Kong to handle a project for two years for the Hong Kong branch of Global. But he still reported his duties to head office in the US. The project required research to be conducted in the PRC and Hong Kong. During the year ended 31 March 2021, he worked for 145 days in Hong Kong, and 220 days in the US and PRC. (Assume 365 days in the year of assessment 2020/21)
The following are the information for the year of assessment 2020/21:-
(1) Salary for the year HK$1,400,000
(2) Bonus HK$340,000
(3) Noel lives with his family in a 2-rooms serviced apartment in Causeway Bay. The rental of the apartment is HK$30,000 per month and this is paid by Global. Noel paid HK$12,000 to join the clubhouse and was reimbursed half of this amount by Global as he would meet clients at the clubhouse for the purpose of fostering business contracts.
(4) During the year, Noel paid HK$25,000 to his family doctor for medical consultations in respect of his family. Noel produced all the medical receipts but Global only approved and reimbursed HK$10,000. Global has not established any medical insurance scheme.
(5) Global provided Noel with a car and a driver. The car was leased from a car agency in the name of Global, at a monthly rental of HK$6,000. The driver was hired by Global at HK$9,600 per month. The total petrol and maintenance costs for the car for the year were HK$80,000, all of which were paid by Noel and reimbursed by Global. Noel estimated that about 20% of the usage of the car did not relate to Global’s business.
(6) Global employed an amah for Noel at a cost of HK$4,500 per month and refunded Noel his utilities bills, which were HK$34,000 for the year.
(7) In January 2021, Noel donated HK$44,000 to the Hong Kong Red Cross.
(8) Noel contributed HK$20,000 to a retirement scheme in the US.
(9) Noel’s wife was not working. He maintained his unmarried daughter (aged 20) who is now studying a full-time degree program in the US.
(10) Noel’s father-in-law, aged 65, lives in a registered care home in Hong Kong and he paid care expenses of HK$120,000 during the year.
REQUIRED:
Q.1 Analyze with reasons the location of Noel’s employment with Global. (5 Marks)
Q.2 Compute the Hong Kong salaries tax liability of Noel for the year of assessment 2020/21. Ignore any provisional tax and tax rebate.
(20 Marks) (Total 25 marks) Due date: 7 March 2022 9:00AM Submitted to Soul, No marks for late submission Handwritten on A4 sized paper and scan in PDF format
Expert Answer

Answers

Tax liability of Noel for the year of assessment 2020/21 is HK$350,760.

A.1 The location of Noel's employment with Global is considered to be in Hong Kong since he was assigned to handle a project for the Hong Kong branch of Global for two years. Although his employment contract was discussed and signed in New York and his salary is paid directly into his bank account in New York, his work responsibilities and duties are primarily based in Hong Kong. This is further supported by the fact that he worked for 145 days in Hong Kong during the year ended 31 March 2021. Therefore, the location of Noel's employment with Global is considered to be in Hong Kong.

A.2 The Hong Kong salaries tax liability of Noel for the year of assessment 2020/21 can be computed as follows:

(1) Salary for the year: HK$1,400,000
(2) Bonus: HK$340,000
(3) Rental value of the serviced apartment: HK$30,000 x 12 = HK$360,000
(4) Reimbursement of clubhouse membership fee: HK$12,000 x 50% = HK$6,000
(5) Reimbursement of medical expenses: HK$10,000
(6) Car and driver benefits: (HK$6,000 x 12) + (HK$9,600 x 12) + HK$80,000 = HK$248,400
(7) Amah and utilities expenses: (HK$4,500 x 12) + HK$34,000 = HK$88,000
(8) Total income: HK$1,400,000 + HK$340,000 + HK$360,000 + HK$6,000 + HK$10,000 + HK$248,400 + HK$88,000 = HK$2,452,400

Deductions:
(9) Donation to Hong Kong Red Cross: HK$44,000
(10) Contribution to retirement scheme in the US: HK$20,000
(11) Dependent parent allowance for father-in-law: HK$50,000
(12) Total deductions: HK$44,000 + HK$20,000 + HK$50,000 = HK$114,000

Net chargeable income: HK$2,452,400 - HK$114,000 = HK$2,338,400

Hong Kong salaries tax liability: HK$2,338,400 x 15% = HK$350,760

Therefore, the Hong Kong salaries tax liability of Noel for the year of assessment 2020/21 is HK$350,760.

To know more about tax liability refer here:

https://brainly.com/question/29857441#

https://brainly.com/question/25641320#

#SPJ11

The 10 Tenets of Environmental management 1. Discuss the weaknesses of the following tenets of environmental management a. Ecological sustainable b.Technologically feasible c. Economically viable d. socially desirable/ tolerable
e. legally permissible

Answers

Difficult to measure the impacts of human activity, technology may not be available are some of  the weaknesses of the following tenets of environmental management .


A. Ecological Sustainable: The weaknesses of this tenet are that it can be difficult to measure the impacts of human activity and to establish a balance between sustainable use.

B. Technologically Feasible: The weaknesses of this tenet are that technology may not be available or affordable for many projects.

C. Economically Viable: The weaknesses of this tenet are that the cost of some projects may be too high for certain regions or populations.

D. Socially Desirable/Tolerable: The weaknesses of this tenet are that there can be conflict between different social groups, and that not all stakeholders may be able to participate in the decision-making process.

E. Legally Permissible: The weaknesses of this tenet are that different laws may be difficult to enforce.

To know more about Environmental Management  click on below link:

https://brainly.com/question/14152938#

#SPJ11

LONG HOURS, HUNDREDS OF EMAILS, AND NO SLEEP
DOES THIS SOUND LIKE A SATISFYING JOB?
Although the 40-hour workweek is now the exception rather than the norm, some individuals are taking things to the extreme:
- John Bishop, 31, is an investment banker who works for Citigroup's global energy team in New York. A recent workday for Bishop consisted of heading to the office for a conference call at 6:00 P.M. He left the office at 1:30 A.M. and had to be on a plane that same morning for a 9:00 A.M. presentation in Houston. Following the presentation, Bishop returned to New York the same day, and by 7:00 P.M., he was back in his office to work an additional 3 hours' Says Bishop, "I might be a little skewed to the workaholic, but realistically, expecting 90 to 100 hours a week is not at all unusual."
- David Clark, 35, is the vice president of global marketing for MTV. His job often consists of travelling around the globe to promote the channel as well as to keep up with the global music scene. If he is not travelling (Clark typically logs 200,000 miles a year), a typical day consists of waking at 6:30 A.M. and immediately responding to numerous messages that have accumulated over the course of the night. He then goes to his office, where throughout the day he responds to another 500, or so messages from clients around the world. If he's lucky, he gets to spend an hour a day with his son, but then it's back to work until he finally goes to bed around midnight. Says Clark, "There are plenty of people who would love to have this job. They're knocking on the door all the time. So that's motivating."
Questions
Given that the two individuals we just read about tend to be satisfied with their jobs, how might this satisfaction relate to their job performance, citizenship behaviour and turnover?

Answers

In the case of John Bishop and David Clark, both individuals seem to be satisfied with their jobs despite the long hours and demanding schedules. Job satisfaction is known to have a positively correlation with job performance, citizenship behavior, and turnover.

This satisfaction is likely to be reflected in their job performance, as they are likely to be motivated and committed to their work. Additionally, their satisfaction may also be reflected in their citizenship behavior, as they are likely to be more willing to help their colleagues and contribute to the overall success of their companies.

Finally, their satisfaction is likely to be reflected in their turnover, as they are less likely to leave their jobs despite the demanding nature of their work. Overall, the satisfaction of these two individuals is likely to be positively related to their job performance, citizenship behavior, and turnover.

To know more about Job satisfaction here:

https://brainly.com/question/28580172#

#SPJ11

Hibou Ltd., a private company based in Vancouver, decided to sell its Industrial Design Division (IDD). After two years of losses and heavy competition, a plan to dispose of the division was put in place. At the end of 2020, the plan was finalized and approved by the board of directors. The sale is anticipated to be completed by June 30, 2021.
Other information:
1. Hibou's 2020 after-tax net income (excluding the results from the Industrial Design Division) was $450,000.
2. During the year, the division (IDD) reported an after-tax loss of $120,000 (revenues: $30,000, expenses: $150,000).
3. Management estimates that after-tax legal and audit fees of $32,000 as well as severance payments of $66,000 will be required to finalize the disposal plan. A portion of these costs is expected to be offset by the after-tax proceeds of $61,000 from the sale of the division's (IDD’s) assets.
Instructions (show all supporting calculations)
Assuming the Industrial Design Division (IDD) qualifies for treatment as a discontinued operation, prepare a partial income statement for Hibou for 2020. The statement should begin with income from continuing operations and include an appropriate footnote pertaining to the disposal of the Industrial Design Division.

Answers

Hibou Ltd.'s Partial Income Statement for 2020, beginning with income from continuing operations:

Revenues: $450,000

Expenses: $450,000

Income from continuing operations: $0

Less: Income (loss) from discontinued operations: ($48,000)

Net income: ($48,000)

Note: The results of the discontinued Industrial Design Division (IDD) included in the above statement are as follows: Revenue: $30,000, Expenses: $150,000, After-tax legal and audit fees: $32,000, Severance payments: $66,000, and After-tax proceeds from sale of IDD assets: $61,000.

Learn more about taxes at https://brainly.com/question/30157668

An investor purchases 1000 shares of stock for $30 per share using a 50% margin. The margin requirement is 50%. From an asset and liability perspective, what does the investor's brokerage account look like immediately after the sale?

Answers

From an asset and liability perspective, the investor's brokerage account would look like this immediately after the sale:

Assets:
- 1000 shares of stock at $30 per share = $30,000

Liabilities:
- Margin loan of 50% of the purchase price = $15,000

Equity:
- The difference between the assets and liabilities = $15,000

So, the investor's brokerage account would have $30,000 in assets, $15,000 in liabilities, and $15,000 in equity immediately after the sale. This is because the investor used a 50% margin to purchase the stock, meaning that they borrowed 50% of the purchase price from their brokerage firm and paid the other 50% with their own money. The margin loan is a liability, while the stock is an asset. The difference between the assets and liabilities is the investor's equity in the account.

For more about investor purchases:

https://brainly.com/question/19612000

#SPJ11

QUESTION 2: HURON LTD
Huron Ltd has identified an indication of impairment and is conducting an impairment review. The carrying amount of cash-generating unit is as follows on 31 Dec, 2021:
£
Goodwill
900,000
Property
2,000,000
Plant and equipment
1,500,000
Computers
600,000
Patents
300,000
Net current assets (net realizable value)
450,000
5,750,000
The whole of the company is considered to be a single cash-generating unit (CGU).
If a company continues its operations, it is estimated to receive £950,000 net cash-flows annually at the end of the year for the duration of next 4 years. The discount rate is calculated to be 7%.
Fair value less cost to sell for CGU is estimated to be £3,050,000.
The net realizable value of the property is £1,300,000 only.
For computers, only half of the value can be recovered. Net Current Assets are recovered in full.
Required
Calculate whether an impairment loss has occurred and if so, prepare a revised schedule for Venus Ltd as at 31 Dec 2018. Show your workings fully clearly showing impairment allocation and revised carrying values.

Answers

The Present Value of future cash-flows (after deducting the costs of disposal of assets) = £2,800,000

To answer this question, we need to calculate whether an impairment loss has occurred for Huron Ltd as at 31 Dec, 2021. To do this, we need to calculate the recoverable amount of the cash-generating unit (CGU).
Recoverable amount of the CGU = Higher of fair value less cost to sell or Value in Use
Fair value less cost to sell = £3,050,000
Value in Use = Present Value of future cash-flows (after deducting the costs of disposal of assets)
The costs of disposal of assets include the following:
- Net realizable value of property = £1,300,000
- Net realizable value of computers = £300,000
- Net current assets = £450,000
Therefore, the Present Value of future cash-flows (after deducting the costs of disposal of assets) = £2,800,000
The recoverable amount of the CGU = Higher of fair value less cost to sell or Value in Use = Higher of £3,050,000 or £2,800,000 = £3,050,000
Therefore, an impairment loss of £1,200,000 (5,750,000 - 3,050,000) has occurred.
The revised schedule for Venus Ltd as at 31 Dec 2021 is shown below:
Goodwill: £900,000
Property: £1,300,000
Plant and Equipment: £1,500,000
Computers: £300,000
Patents: £300,000
Net current assets (net realizable value): £450,000
Total carrying value: £4,550,000

Learn more about cash-flows: https://brainly.com/question/24179665

#SPJ11

All of the following are specifically identifiable intangibles except:
Trademarks
Goodwill
Patents
Copyrights.
Intangible assets that have a finite life are amortized over a period not to exceed:
Their useful life.
Their legal life.
20 years.
40 years.

Answers

Goodwill is not a specifically identifiable intangible asset and intangible assets with a finite life are amortized over their useful life.

The correct answers to the questions are:

1) Goodwill: Goodwill is not a specifically identifiable intangible asset. It is an intangible asset that arises from the acquisition of one company by another company and is not specifically identifiable. Goodwill represents the value of a company's brand name, customer relationships, and other intangible assets that are not specifically identifiable.

2) Their useful life: Intangible assets that have a finite life are amortized over their useful life. The useful life of an intangible asset is the period of time over which the asset is expected to contribute to the future cash flows of the company. The useful life of an intangible asset may be shorter than its legal life, and it is the useful life that should be used for amortization purposes.

For more about intangibles:

https://brainly.com/question/29916481

#SPJ11

How must personal information be secured to comply with the
requirements of the Commonwealth Privacy Act 1988? (APP)

Answers

Personal information must be secured in a way that ensures the privacy of individuals and complies with the requirements of the Commonwealth Privacy Act 1988 (APP).

Commonwealth Privacy Act 1988 (APP)

This includes using appropriate security measures, such as encryption, to protect personal information from unauthorized access, modification, or disclosure. It also includes implementing policies and procedures to ensure that personal information is only collected, used, and disclosed in accordance with the APP.

Additionally, organizations must take reasonable steps to ensure that personal information is accurate, up-to-date, and complete, and that it is protected from misuse, loss, or unauthorized access. By taking these steps, organizations can ensure that they are complying with the APP and protecting the privacy of individuals.

See more about privacy at: https://brainly.com/question/15874750

#SPJ11

(0)
The Board of Directors of M/S Bajaj Auto Ltd. met and decided to make certain adjustments in the existing staff of its Akurdi plant. After the meeting, the Managing Director informally told his Secretary that there may be changes in the staffing pattern of Akurdi plant. The Secretary told her friends during lunch break that the plant would soon be laying off employees. Even though, she took a promise that they will not tell anybody, her friends sounded some employees of the plant about the impending danger. The employees’ union not only presented memorandum to the authorities but served a notice to go on strike also.
Questions(5M)
1. Identify the barriers of communication in the case.(2M)
2. Was there any encoding and decoding of message?(2M)
3. What lessons do you draw from the issue by assuming you as the Managing Director?(1M)

Answers

1. The barriers of communication in this case are the informal and unofficial nature of the information being shared, the potential for misunderstanding and misinterpretation of the information, and the lack of control over how the information is spread.

The Managing Director's informal conversation with his Secretary was not an official communication and therefore should not have been treated as such. The Secretary's decision to share the information with her friends, despite taking a promise of secrecy, also contributed to the spread of misinformation and the potential for misunderstanding.

Additionally, the employees' union's decision to take action based on unofficial and potentially inaccurate information further exacerbated the situation.



2. Yes, there was encoding and decoding of the message. The Managing Director encoded his message when he informally told his Secretary about the potential changes in the staffing pattern of the Akurdi plant. The Secretary then decoded the message and encoded it again when she shared it with her friends.

Her friends decoded the message and encoded it again when they shared it with the employees of the plant. The employees' union decoded the message and encoded it again when they presented a memorandum to the authorities and served a notice to go on strike.



3. As the Managing Director, the lessons that can be drawn from this issue are the importance of clear and official communication, the need for discretion when sharing sensitive information, and the potential consequences of sharing unofficial and potentially inaccurate information.

It is important to ensure that all official communication is clear and accurate, and that sensitive information is only shared with those who need to know and can be trusted to keep it confidential.

Additionally, it is important to be aware of the potential consequences of sharing unofficial and potentially inaccurate information, as it can lead to misunderstandings, misinterpretations, and unnecessary actions.

To know more about Director refer to-

brainly.com/question/28267841#
#SPJ11

Provide a synopsis of your EQ development during the course. Has the level of emotional intelligence (EI) changed? Synthesize your statement(s) with at least one EI learning concept which resonated with you

Answers

One way to reflect on your EQ development is to consider how you have responded to different situations during the course. Another way to reflect on your EQ development is to consider how your relationships with others have changed.

Have you been able to regulate your emotions and respond appropriately? Have you been able to empathize with others and understand their emotions? These are important aspects of emotional intelligence. Have you been able to form deeper connections with your classmates or instructor? Have you been able to communicate more effectively with others?
One EI learning concept that may resonate with you is the idea of emotional self-awareness. This concept involves being able to recognize and understand your own emotions and how they impact your behavior. By developing emotional self-awareness, you can better regulate your emotions and respond appropriately to different situations.
Overall, it is important to reflect on your EQ development during a course and consider how you have grown in terms of emotional intelligence. By synthesizing your reflections with EI learning concepts, you can gain a deeper understanding of your own emotional intelligence and how it impacts your relationships and experiences.

For such more questions on emotional intelligence:

brainly.com/question/30435483

#SPJ11

CASE STUDYGM recalling 7 million vehicles for airbag problems after losing fight with safety regulator GM is recalling 7 million pickups and SUVs worldwide with airbags made by the same manufacturer whose airbags are linked to at least 17 deaths in the United States. The National Highway Traffic Safety Administration ordered a US recall on Monday, rejecting GM's argument that this version of the airbags didn't need to be replaced. The recall centers on a defect in airbags made by Takata, a now-bankrupt Japanese manufacturer, that caused the bags to explode, spraying shrapnel through the vehicle. In addition to the deaths, other drivers or passengers have been blinded or maimed. The decision comes more than six years after initial recalls linked to the Takata airbags began in 2014, ultimately becoming the largest auto recall in history. Prior to Monday's announcement, the US portion of the recall had already reached 63 million airbags in roughly 40 million vehicles. The airbag scandal has led to a slow and painful demise for Takata, which started out as a textile manufacturer more than 80 years ago and later came to specialize in seat belts and other auto safety equipment. "The sad saga of Takata ... has resulted in the implosion of one of the automotive industry's oldest and most successful suppliers due to technical hubris, mismanagement and a systemic corporate culture of manipulation," said Scott Upham, the CEO of Valient Market Research. Earlier this year, Takata admitted to manipulating and withholding key information about the faulty inflators for years, even after they started exploding in people's cars. It pleaded guilty in the U.S. to a criminal charge of wire fraud for which it will have to pay $1 billion, including a $125 million fund to compensate victims and their families. GM had previously recalled nearly 800,000 vehicles with Takata airbags, but had argued that its tests showed the airbags in these additional vehicles, which have a different kind of inflator than the devices in the earlier recall, did not pose a threat. The dispute between GM and the safety regulator has been going on for four years. On Monday, NHTSA rejected GM's argument and ordered it to recall 5.9 million of the vehicles registered in the United States. "NHTSA concluded that the GM inflators in question are at risk of the same type of explosion after long-term exposure to high heat and humidity as other recalled Takata inflators," said the agency. GM said it would comply by recalling those domestic vehicles and another 1.1 million of the same models elsewhere in the world. But it said it remains convinced the airbags do not pose a threat. "We believe a recall of these vehicles is not warranted based on the factual and scientific record," said GM. "However, we will abide by NHTSA's decision and begin taking the necessary steps." The latest recall will be expensive for GM, costing the automaker about $1.2 billion according to its most recent annual financial report early this year. Because of Takata's bankruptcy, GM will have to pay all costs itself. The company expects to spend about $400 million next year, and the additional funds in subsequent years. Only about 75% of the earlier recalled GM vehicles have been brought in to be fixed despite the fact that the recall started more than six years ago. The recalls are done at no cost to the vehicle owners. There is no deadline by which recalled vehicles must be repaired or replaced. The recall covers the Cadillac Escalade, the Chevrolet Avalanche, Silverado, Suburban and Tahoe and the GMC Sierra and Yukon, with model years 2007 to 2014. Question 1 According to the case above, it is clear that Takata did not meet all the criteria for supplier for a good supplier. Citing evidence from the case, explain the factors that GM did not consider when selecting Takata as a supplier. Question 2 Supply management must maintain a number of communication flows and linkages between other key groups within and external to the organisation. Explain GM's supply management's relationships with internal linkages, within the organisation as well as external linkages that may have been important in avoiding the mistakes in supplier selection.

Answers

According to the case, it is clear that Takata did not meet all the criteria for a good supplier because of their technical hubris, mismanagement, and a systemic corporate culture of manipulation.

GM's supply management's relationships with internal linkages, within the organization, are crucial for ensuring that all departments are aware of the supplier selection process and the criteria that are being used to select suppliers.

These factors led to the production of faulty airbags that caused at least 17 deaths and numerous injuries. GM did not consider the ethical practices and the quality control measures of Takata when selecting them as a supplier. Additionally, GM did not consider the financial stability of Takata, which ultimately led to their bankruptcy and the inability to cover the costs of the recall.

This includes communication with the engineering department to ensure that the supplier's products meet the technical specifications, the finance department to ensure that the supplier is financially stable, and the legal department to ensure that the supplier is following ethical practices.

External linkages, such as relationships with regulatory agencies and industry associations, are also important for ensuring that the supplier is following industry standards and regulations. By maintaining these communication flows and linkages, GM could have avoided the mistakes in supplier selection and prevented the production of faulty airbags.

For such more question on supplier:

https://brainly.com/question/14885967

#SPJ11

Your purchase a financial instrument which will pay $10 per year
for ever. If the interest year is 2%, what is its value?

Answers

The value of a financial instrument that pays a fixed amount per year for an indefinite amount of time is known as the present value of a perpetuity. The formula for calculating the present value of a perpetuity is:

Present Value = Payment Amount / Interest Rate

In this case, the payment amount is $10 per year and the interest rate is 2%. Therefore, the present value of this financial instrument is:

Present Value = $10 / 0.02 = $500

So, the Present value of this financial instrument is $500.

To know more about Present Value

https://brainly.com/question/17322936

#SPJ11

A firm invests in a project that costs $100,000 and has the following projected net cash flows. When is payback expected? year 1 - $20,000 year 2 - $30,000 year 3 - $40,000 year 4 - $10,000 year 5 - $20,000 year 6 - $15,000 group of answer choices 7 years 5 years 3 years 4 years

Answers

7 years is the payback expected time when A firm invests in a project that costs $100,000

The payback period is the amount of time needed for an investor to break even or recover the cost of their investment. Payback periods that are longer are less appealing than those that are shorter. The payback period is calculated by dividing the investment amount by the annual cash flow. Account and fund managers utilise the payback time to determine whether to move forward with an investment. The payback period has the problem of not taking the time value of money into account.

To learn more about payback refer here:

https://brainly.com/question/13978071

#SPJ4

Ethics Project
Decision 3 Taylor decided to turn in the proposal based on the higher projected IRR due to the cost reclassification. Consequences of Behavioral Action: The project was funded and, when completed, the IRR came in much higher than expected. Taylor was able to reverse the reclassification by reinstating the omitted expenditure back to the project rather than normal operations and still achieve an IRR of 8% on the project. One year later Taylor was promoted to vice president.
Decision 4 Taylor decided to turn in the proposal with a 7.5% IRR and it was not accepted. Taylor was not promoted.

Answers

It is clear from the scenario presented that there were different consequences for each of the decisions made by Taylor. In Decision 3, Taylor made the unethical choice to reclassify costs in order to increase the projected IRR and get the project funded.

However, when the project was completed, the IRR came in much higher than expected, allowing Taylor to reverse the reclassification and still achieve a satisfactory IRR. As a result of this decision, Taylor was promoted to vice president.
In contrast, in Decision 4, Taylor made the ethical choice to turn in the proposal with a lower IRR, which resulted in the proposal not being accepted. As a result of this decision, Taylor was not promoted.
It is important to note that while Taylor was rewarded for his unethical behavior in Decision 3, this does not necessarily mean that unethical behavior is always rewarded. In fact, there are often negative consequences for unethical behavior, including damage to one's reputation, loss of trust from colleagues and superiors, and even legal consequences. Therefore, it is important to always make ethical decisions, even if there may be short-term benefits to unethical behavior.

For more question on loss click on

https://brainly.com/question/13248152

#SPJ11

For which capital component must you make a tax adjustment when calculating a firm’s weighted average cost of capital (WACC)?
a. Common stock
b. Preferred stock
c. Debt
Cold Goose Metal Works (CGMW) can borrow funds at an interest rate of 10.20% for a period of eight years. Its marginal federal-plus-state tax rate is 30%. CGMW’s after-tax cost of debt is (rounded to two decimal places).
At the present time, Cold Goose Metal Works (CGMW) has a series of five-year noncallable bonds with a face value of $1,000 that are outstanding. These bonds have a current market price of $1,438.04 per bond, carry a coupon rate of 14%, and distribute annual coupon payments. The company incurs a federal-plus-state tax rate of 30%. If CGMW wants to issue new debt, what would be a reasonable estimate for its after-tax cost of debt (rounded to two decimal places)?
a. 0.0332
b. 0.0289
c. 0.026
d. 0.0347

Answers

For Debt capital component you must  make a tax adjustment when calculating a firm’s weighted average cost of capital (WACC).


Cold Goose Metal Works (CGMW) can borrow funds at an interest rate of 10.20% for a period of eight years. Its marginal federal-plus-state tax rate is 30%. CGMW’s after-tax cost of debt is 0.026 (rounded to two decimal places).


At the present time, Cold Goose Metal Works (CGMW) has a series of five-year noncallable bonds with a face value of $1,000 that are outstanding. These bonds have a current market price of $1,438.04 per bond, carry a coupon rate of 14%, and distribute annual coupon payments.

The company incurs a federal-plus-state tax rate of 30%. If CGMW wants to issue new debt, A reasonable estimate for CGMW's after-tax cost of debt is 0.0347 (rounded to two decimal places). This is calculated by subtracting the tax rate (30%) from the coupon rate (14%) to get the pre-tax cost of debt (8%), and then multiplying this by (1-tax rate) to get the after-tax cost of debt.

To know more about Debt capital component refer to-

brainly.com/question/15181122#

#SPJ11

(b) Explain any FOUR
(4) differences between financial accounting and cost
accounting.

Answers

Financial accounting and cost accounting are two types of accounting used to evaluate the financial performance of a business.

The key differences between them include:

Purpose: Financial accounting focuses on providing financial information to external stakeholders, while cost accounting focuses on providing internal stakeholders with cost-related information.
Regulation: Financial accounting is generally more heavily regulated than cost accounting.
Audience: Financial accounting reports are intended for external audiences, such as investors, creditors, and tax authorities, while cost accounting reports are typically intended for internal audiences such as managers and executives.
Time Period: Financial accounting reports are generally prepared on an annual basis, while cost accounting reports may be prepared on a monthly, quarterly, or annual basis.

See more about financial accounting at: https://brainly.com/question/13592085

#SPJ11

Question 28 (5 points) Please calculate the A. Exercise Value B. Time Value Given the following: Price of stock $55 Exercise Value Strike Price $47.50 Time Value Market value $10.50 Question 29 (6 points) We spent some time analyzing options in detail. Please take time to explain: 1. The difference between American Options and European Options. 2. The difference between a Put and a Call 3. The difference between the Black Scholes option pricing model and the Binomial Option pricing model.

Answers

The time value of an option is the difference between the market value of the option and its exercise value. It represents the value of the option based on the time remaining until expiration is $3.00.

A. Exercise Value
The exercise value of an option is the difference between the price of the underlying asset and the strike price of the option. It is the amount that the option holder would receive if they exercised the option at the current price of the underlying asset.
Exercise Value = Price of Stock - Strike Price
= $55 - $47.50
= $7.50
B. Time Value
The time value of an option is the difference between the market value of the option and its exercise value. It represents the value of the option based on the time remaining until expiration.
Time Value = Market Value - Exercise Value
= $10.50 - $7.50
= $3.00

Question 29
1. The difference between American Options and European Options:
American options can be exercised at any time before the expiration date, while European options can only be exercised on the expiration date.
2. The difference between a Put and a Call:
A call option gives the holder the right to buy an underlying asset at a specified price, while a put option gives the holder the right to sell an underlying asset at a specified price.
3. The difference between the Black Scholes option pricing model and the Binomial Option pricing model:
The Black Scholes model is a mathematical formula that is used to price options based on the current price of the underlying asset, the strike price, the time until expiration, and other factors. The Binomial Option pricing model is a method that uses a tree diagram to calculate the value of an option based on the possible outcomes of the underlying asset's price movements.

For more question on Stock click on

https://brainly.com/question/28452798

#SPJ11

1. Explain the development of brand personality of Rolex and Richard Mille separately. While doing that, students will need to give a timeline of product development, communication, distribution along with the identification of target segments for both of these brands separately. Basically, students need to decide clearly with these two examples, how brands should be working to clarify their identities with distinct personalities. Students will need to carry out an intensive study of the brands on their respective websites and other materials that they might find in the internet.

Answers

Rolex has been a leader in the watchmaking industry since its inception in 1905. Early on, the brand focused on creating highly reliable and accurate timepieces that could be used in outdoor and underwater activities.

Over the years, Rolex has developed its brand personality by focusing on luxury and opulence, creating iconic designs that have become status symbols. It has positioned itself as a brand of distinction, aiming to be the ultimate symbol of success and achievement. Its product lineup has evolved over the years to include a wide range of luxury watches and accessories, and its distribution network has been expanded to reach customers around the world.

Richard Mille, on the other hand, has built a brand personality based on its commitment to innovation and technology. Since its inception in 2001, the brand has focused on creating luxurious timepieces that incorporate cutting-edge materials and technologies.

Its products are designed to be lightweight and highly resistant to shocks, making them ideal for sports and everyday use. Its distribution network has also been expanded to reach customers around the world, and its marketing strategies have focused on communicating the brand's technical expertise and innovative approach to watchmaking.

Know more about Rolex here

https://brainly.com/question/29752806#

#SPJ11

Brief summary and critique on this article and the ninefactors discussed :Making Strategy Work: A Literature Review on the Factorsinfluencing strategic implementation / ICA working paper 2/2008

Answers

The article "Making Strategy Work: A Literature Review on the Factors influencing Strategic Implementation" by Alexander T. Nicolai and Julia Holtbrügge discusses the importance of strategic implementation in organizations and the factors that influence its success.

The authors conducted a literature review of previous research on strategic implementation and identified nine factors that influence its success: 1) communication, 2) leadership, 3) culture, 4) structure, 5) control, 6) human resources, 7) external environment, 8) strategic fit, and 9) resources.

The authors argue that these factors are interconnected and that organizations must consider all of them when implementing a strategy. They also discuss the importance of aligning the organization's structure, culture, and control systems with the strategy in order to ensure its success. The authors conclude that further research is needed to understand how these factors interact and to develop practical guidelines for organizations.

Overall, the article provides a comprehensive review of the literature on strategic implementation and identifies the key factors that influence its success. The authors' use of previous research and their identification of the nine factors make the article a valuable resource for organizations and researchers interested in strategic implementation.

For such more question on Literature:

https://brainly.com/question/13098221

#SPJ11

Other Questions
What is the problems of photosynthesis? Eight triangles are drawn within a square to create the shaded region in the figure. InstructionsRead the question carefully and select the best answer.Based on the following passage, which of the following best explains why factions might develop?The latent causes of faction are thus sown in the nature of man; and we see them everywhere brought into different degrees of activity,according to the different circumstances of civil society. A zeal for different opinions concerning religion, concerning government, and many otherpoints, as well of speculation as of practice; an attachment to different leaders ambitiously contending for pre-eminence and power; or to personsof other descriptions whose fortunes have been interesting to the human passions, have, in turn, divided mankind into parties, inflamed them withmutual animosity, and rendered them much more disposed to vex and oppress each other than to co-operate for their common good.DA It is natural for individuals to have different opinions. How could the North's factories be considered an advantage? (I point)O The factories could sell surplus goods to Europe for money.O The factories could be converted to making supplies for the army.OThe factories could get cotton from the West instead.OThe factories could use newly freed African Americans as a cheap source of labor. In the 2020 NFL season, Drew Brees completed 73.5% of his attempted passes, and Patrick Mahomes completed 68.8% of his attempted passes. Based on those statistics, which of the following statements is true? A. Drew Brees must have attempted more passes B.Patrick Mahomes must have completed more passes C.Either quarterback could have completed more passes D.. Drew Brees must have completed more passes Faisal deposits a single sum of money into an investment opportunity that pays 1% compounded annually. How much must he deposit in order to withdraw $3,024/year for 5 years, with the first withdrawal occurring 2 year after deposit? Qustion#3 [4+6](a) Impact of culture is pervasive.- Explain the statement.(b) What are some particularly troublesome problems caused bylanguage in foreign marketing? Discuss. Find the constant of variation k for the direct variation.f(x)0-1-2-3.5x02047 Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor