a 1500 kg car traveling at 30 m/s has the same kinetic energy as a 4500 kg truck what is the speed of this truck

Answers

Answer 1

The speed of the truck is approximately 17.32 m/s when a 1500kg ha sthe same Kinetic energy as a 4500kg truck.

The kinetic energy (KE) of an object is given by the formula:

[tex]KE = (1/2) * m * v^2[/tex]

where m is the mass of the object and v is its velocity.

In this problem, we are given that the kinetic energy of a 1500 kg car traveling at 30 m/s is the same as the kinetic energy of a 4500 kg truck. Therefore, we can write:

[tex](1/2) * 1500 * 30^2 = (1/2) * 4500 * v^2[/tex]

Simplifying this equation, we get:

[tex]675000 = 2250 * v^2[/tex]

Dividing both sides by 2250, we get:

[tex]v^2 = 300[/tex]

Taking the square root of both sides, we get:

[tex]v = \sqrt (300) = 17.32 m/s[/tex]

Kinetic energy (KE) is the energy that an object possesses due to its motion. Any object that is in motion has kinetic energy, and the amount of kinetic energy it has depends on its mass and velocity.

learn more about kinetic energy here:

https://brainly.com/question/26472013

#SPJ1


Related Questions

Elements are pure substances that make up all matter. Gold, aluminum, iron, and lead are some examples of these pure substances. What is the basic building block of all pure substances that make up matter in the world?

A metalsmetals
B cellscells
C compoundscompounds
D atoms

Answers

Answer: All matter is made up of very small particles called atoms.

Explanation:Atoms are the basic building blocks of ordinary matter

before connecting this 10uf capacitor to a 5 resistor, it was connected to a 6 v battery what is the current in the resistor how long will it take the voltage across the capacitor to drop in 60% its initial value?

Answers

It will take approximately 24.3 microseconds for the voltage across the capacitor to drop to 60% of its initial value.

To determine the current in the resistor, we need to use Ohm's Law:

I = V/R

where I is the current,

V is the voltage,

and R is the resistance.

In this case, the voltage across the resistor is the same as the voltage across the capacitor, which was 6 V before the capacitor was connected to the resistor.

Therefore:

I = 6 V / 5 Ω = 1.2 A

So the current in the resistor is 1.2 A.

To determine how long it will take for the voltage across the capacitor to drop to 60% of its initial value, we can use the formula for capacitor voltage over time:

[tex]Vc(t) = V0 * e^(-t/RC)[/tex]

where Vc(t) is the voltage across the capacitor at time t,

V0 is the initial voltage across the capacitor, e is the mathematical constant e (approximately 2.71828),

t is time, R is the resistance in ohms, and C is the capacitance in farads.

We are given that the capacitance is 10 µF, or

[tex]10 * 10^-6 F.[/tex]

Assuming the resistor is still 5 Ω, we can calculate the time it takes for the voltage across the capacitor to drop to 60% of its initial value as follows:

0.6 * 6 V = 3.6 V (60% of the initial voltage)

3.6 V = 6 V * [tex]e^(-t/(5 * 10 µF))[/tex]

[tex]e^(-t/(50 µs)) = 0.6[/tex]

Taking the natural logarithm of both sides:

-t/(50 µs) = ln(0.6)

t = -50 µs * ln(0.6)

t ≈ 24.3 µs

For similar question on voltage.

https://brainly.com/question/14883923

#SPJ11

The motion of Earth's molten rock shows characteristic patterns which can be analyzed and explained scientifically. Such analysis and explanation is impossible without understanding the principles of which kind of energy? A chemical B electrical C thermal D radiant

Answers

Answer: C) thermal energy.

Explanation:The motion of Earth's molten rock (such as in the mantle) and the resulting patterns can be analyzed and explained scientifically by understanding the principles of thermal energy. This is because the movement of the molten rock is primarily driven by the transfer of heat and temperature differences within the Earth's interior, leading to processes like convection and heat conduction.

2. A(n)
the same distance and the same direction.

Answers

Answer:

"Translation" simply means moving. In a translation, every point of the shape must move the same distance and in the same direction.

a sunflower seed is buried in soil and watered. soon, the seed grows strong enough to break out of its seed coat. what is true of the forces involved as the seed emerges from the top of the seed coat?

Answers

The force that allows the sunflower seed to emerge from its seed coat is: generated by the pressure from the growing embryo inside the seed coat, not any outside force.

The forces involved as a sunflower seed emerges from its seed coat are generated by the expanding plant embryo, which grows as it absorbs water and nutrients. As the embryo grows, its cells divide and become more specialized, and it increases in size, causing the seed coat to become too small to contain the growing plant.

The embryo puts pressure on the seed coat until it splits and the plant emerges. This force is due to the pressure generated by the expanding plant embryo, not any outside force. The embryo contains hormones, proteins, and other substances that cause cells to divide and specialize, which increases its size and puts pressure on the seed coat.

As it does this, the outer layers of the seed coat split, allowing the embryo to emerge. This force is not caused by gravity or any other external force. In conclusion, the force that allows the sunflower seed to emerge from its seed coat is generated by the pressure from the growing embryo inside the seed coat, not any outside force.

To know more about force refer here:

https://brainly.com/question/26115859#

#SPJ11

how the spring potential energy depends on the kinetic energy and the gravitational potential energy of the object

Answers

The more the kinetic energy of the object attached, more will be the maximum potential energy of the spring. Similarly, if object is hanging in vertical direction, maximum potential energy of the spring will be more if gravitational potential energy is high.

The spring potential energy depends on the kinetic energy and the gravitational potential energy of the object in the following way:

When an object is lifted to a certain height, it gains potential energy, which is referred to as gravitational potential energy. When an object is in motion, it possesses kinetic energy. When an object is compressed or stretched, it acquires potential energy, which is referred to as spring potential energy. Spring potential energy is the energy saved in the compressed or extended state of the spring. When the spring is no longer extended or compressed, it is released and the potential energy is transformed into kinetic energy. When the spring is compressed, its potential energy is at its maximum. When the spring is fully extended, the potential energy is at its minimum. When a force acts on the spring, it gains kinetic energy, which is transformed into spring potential energy after a certain distance.

Spring potential energy formula: Elastic potential energy = (1/2) kx²

Where,k = spring constant x = displacement of spring.

To learn more about kinetic energy refer to: brainly.com/question/25959744

#SPJ11

g at 2m a thechnoloist observed that the activity levle from a source is 45mr/hr. what is the activity reading at 6 meters from the source?

Answers

The activity reading at 6 meters from the source as observed by the technologist will be  5mR/hr

The activity reading at 6 meters from the source can be calculated using the inverse square law, which states that the radiation intensity is inversely proportional to the square of the distance from the source. Therefore, the activity reading at 6 meters from the source can be calculated as follows:

Activity at 6m = (Distance at 1st measurement / Distance at 2nd measurement)² x Activity at 2m

Activity at 6m = (2m / 6m)² x 45mR/hr

Activity at 6m = (1/9) x 45mR/hr

Activity at 6m = 5mR/hr

Therefore, the activity reading at 6 meters from the source is 5mR/hr. This calculation demonstrates that as the distance from a radiation source increases, the radiation intensity decreases significantly, which is a fundamental principle in radiation safety.

It is essential to maintain appropriate distances from radiation sources and use appropriate protective equipment to minimize exposure to ionizing radiation.

To know more about inverse square law, refer here:

https://brainly.com/question/30562749#

#SPJ11

night who could help me with this good two points and thank you very much please [if you can specify where to get that answer I appreciate it]

Answers

1). The current in the circuit is 0.9 A.

Using Ohm's Law, we can find the current in the circuit:

I = V/R

In this case, the resistance is 10 ohms and the voltage is 9V, so we have:

I = 9V / 10 ohms = 0.9 A

Therefore, the current in the circuit is 0.9 A.

2). The voltage in the circuit is 120.05 V.

Using Ohm's Law, we can find the voltage in the circuit:

V = I*R

In this case, the resistance is 35 ohms and the current is 3.43 A, so we have:

V = 3.43 A * 35 ohms = 120.05 V

Therefore, the voltage in the circuit is 120.05 V.

3). To find the resistance of the circuit from the graph, the resistance of the circuit is 2 ohms.

Resistance (R) = Voltage (V) / Current (I)

Since the graph shows a straight line, it means that the resistance of the circuit is constant. We can find the resistance of the circuit by calculating the slope of the line.

Slope = Rise / Run = ΔV / ΔI

Looking at the graph, we can see that the voltage increases by 4V when the current increases by 2A. Therefore:

ΔV = 4V

ΔI = 2A

Slope = ΔV / ΔI = 4V / 2A = 2 ohms

Therefore, the resistance of the circuit is 2 ohms.

4). The current pass through the circuit is [tex]I_{2}[/tex] is 2 A.

We can solve this problem by using the principle of conservation of energy. The total energy provided by the battery is equal to the sum of the energy dissipated by the resistors. Since the resistors are connected in parallel, the voltage across each resistor is the same.

The energy dissipated by a resistor is given by the formula:

E = I^2 x R x t

where E is the energy dissipated, I is the current flowing through the resistor, R is the resistance of the resistor, and t is the time for which the current flows.

For the circuit with resistor R1, the energy dissipated is:

E1 = I x R1 x t

For the circuit with resistor R2, the energy dissipated is:

E2 = I2 x R2 x t

Since the batteries are identical, the total energy provided by the battery is the same for both circuits. Therefore, we have:

E1 + E2 = I x R1 x t + I2 x R2 x t

Substituting the given values, we get:

2 x (30) x t + I2 x (45) x t = 2 x (30 + 45) x t

Simplifying, we get:

60t + 45I2t = 150t

15I2t = 90t

[tex]I_{2}[/tex] = 6 A/3 = 2 A

Therefore, the value of [tex]I_{2}[/tex] is 2 A.

To know more about current, visit:

https://brainly.com/question/31051471

#SPJ1

a rotating wheel requires 2.93 s to rotate through 37.0 revolutions. its angular speed at the end of the 2.93 s interval is 98.9 rad/s. what is the constant angular acceleration of the wheel?

Answers

The constant angular acceleration of the wheel is: 33.80 rad/s²`.

How to determine the constant angular acceleration of the wheel?

To determine the constant angular acceleration of a wheel, you can use the formula for angular acceleration which is given as: (final angular velocity - initial angular velocity) divided by time.
α= (ωf-ωi)/t    

The initial angular velocity is zero since the wheel starts from rest, so it can be assumed as zero.
Then, you can substitute the given final angular velocity and the time taken to reach that velocity in the formula to calculate the angular acceleration of the wheel.
Once the values are substituted, simplification can be done to obtain the numerical value of the angular acceleration in radians per second squared.
In the given example, the final angular velocity is 98.9 rad/s and the time taken to reach that velocity is 2.93 seconds. Substituting these values in the formula:
α= (98.9 rad/s - 0)/2.93s`Simplifying gives`α= 33.80 rad/s²`

To learn more about "Angular acceleration" here:

https://brainly.com/question/29428475#

#SPJ11

what would have happened if the cosmological constant of hydrogen were slightly larger? group of answer choices the stars would have burned out too soon for life to be given a chance to form the stars would not have been sufficiently large enough to maintain warm temperatures hydrogen would have been the only element in the universe, and life would not have emerged hydrogen would have been converted to helium, and there would be no enduring formulation of stars

Answers

The consequences if the cosmological constant of hydrogen were slightly larger would be that the stars would have burned out too soon for life to be given a chance to form.

In cosmology, the cosmological constant is a constant term introduced by Albert Einstein into his field equations of general relativity. It represents the energy density of the vacuum of space.

In the theory of general relativity, it is presumed to act as a cosmological repulsive force for accelerating the Universe's expansion. The cosmological constant is widely considered one of the best contenders for dark energy.

According to present observations, dark energy accounts for approximately 68 percent of the total energy in the Universe, while the remaining 27 percent is dark matter, which cannot be detected by electromagnetic radiation. The remaining 5% is standard matter.

Hence, this means that the cosmological constant is essential in sustaining the Universe as it is.

To answer the question, the consequences of a slightly larger cosmological constant of hydrogen would be that the stars would have burned out too soon for life to be given a chance to form.

Know more about cosmological constant here:

https://brainly.com/question/29427155

#SPJ11

yolanda, whose mass is 38.4 kg, is riding in an elevator that has an upward acceleration of 2.13 m/s2. what force does she exert on the floor of the elevator? if the force is in upward direction, enter a positive value and if it is in downward direction, enter a negative value.

Answers

If the elevator is in the upward direction, the force that Yolanda exerts on the floor of the elevator is 81.792 N.

The force that Yolanda exerts on the floor of the elevator can be calculated using Newton's second law of motion, which states that force is equal to mass times acceleration:

force = mass x acceleration

In this case, Yolanda's mass is 38.4 kg, and the upward acceleration of the elevator is 2.13 m/s². So, we can plug these values into the formula:

force = 38.4 kg x 2.13 m/s²

force = 81.792 N

Since the elevator is accelerating upwards, the force that Yolanda exerts on the floor of the elevator is also upwards, so the answer is positive.

Learn more about force here:

https://brainly.com/question/13526583

#SPJ11

Bobo the clown carries two red balloons that rub against a circus elephant, causing thr baloons to seperate. Each balloon aquires 1.2x10^-7 of charge. How large is the electric orce between them when the balloons are seperated by a distance of 0.5m

Answers

The electric force between the two balloons is approximately 1.04 x [tex]10^{-12}[/tex] N.

Coulomb's Law:

The electric force between two charged objects can be calculated using Coulomb's Law, which states that the magnitude of the electric force F between two charged objects is directly proportional to the product of their charges (q1 and q2) and inversely proportional to the square of the distance (r) between them:

F = k * (q1 * q2) / r²

where k is the Coulomb constant, which has a value of approximately 9.0 x [tex]10^{9}[/tex] N*[tex]m^{2}[/tex]/[tex]C^{2}[/tex].

In this case, each balloon acquires a charge of 1.2 x [tex]10^{-7}[/tex] C, so the total charge on both balloons is 2 * 1.2 x [tex]10^{-7}[/tex]C = 2.4 x [tex]10^{-7}[/tex]C. The distance between the balloons is 0.5 m.

Plugging in these values into Coulomb's Law, we get:

F = (9.0 x [tex]10^{9}[/tex] N*[tex]m^{2}[/tex]/[tex]C^{2}[/tex]) * [(1.2)²x ([tex]10^{-7}[/tex] C)²/ (0.5m)²]

Simplifying this expression gives:

F = 1.0368 x [tex]10^{-12}[/tex] N

Therefore, the electric force between the two balloons is approximately 1.04 x[tex]10^{-12}[/tex]    N.

What is magnitude?

Magnitude refers to the size or extent of something, usually measured in numerical or quantitative terms. It can refer to a physical quantity, such as length, mass, or volume, or it can refer to other measurable attributes, such as brightness, intensity, or force. In general, magnitude is a relative measure, meaning that it is typically expressed as a comparison between two or more things.

To know more about magnitude, visit:

https://brainly.com/question/14452091

#SPJ1

when dr. hewitt cuts the broom right through the center of gravity, how do the weights of the two sides of the broom compare?

Answers

If Dr. Hewitt cuts the broom exactly through its center of gravity, then the weights of the two sides of the broom will be equal.

This is because the center of gravity is the point at which the weight of the object can be considered to be concentrated, and cutting the object at this point would result in two halves of equal weight.

However, it is important to note that if the broom is not perfectly symmetrical, the location of the center of gravity may not be at the exact physical center of the broom. In this case, Dr. Hewitt would need to locate the actual center of gravity of the broom and cut it at that point to achieve equal weights on each side.

Nonetheless, if the broom is cut exactly at its center of gravity, the weights of the two sides of the broom will be equal regardless of its shape or size.

Therefore, if the broom is cut exactly at its center of gravity, each half will have half the total weight of the broom.

To learn more about center of gravity:

https://brainly.com/question/4208016

#SPJ11

alpha particles (charge q= qe, mass m=6.6 x 10^6 x 10^27 kg) move at 1.6 x 10^6 m/s. what magnetic field strength would be required to bend them to a circular path of radius r=0.14 m

Answers

The magnetic field strength required to bend alpha particles to a circular path of radius r=0.14 m is 0.1975 T.

Determining the magnetic field strength:

First, we are to calculate the magnetic field required to bend alpha particles to a circular path of radius r = 0.14 m using the equation;r = (mv) / (qB) Where r = 0.14 mm, v = 1.6 × [tex]10^{6}[/tex] m/sq = q, e = 1.6 × [tex]10^{-19}[/tex] C, B = magnetic field Strength (T).

By substituting the values given above into the equation, we have 0.14 = (6.6 × [tex]10^{-27}[/tex] × 1.6 × [tex]10^{6}[/tex])/(1.6 × [tex]10^{-19}[/tex] × B). Simplifying the equation further, we have B = 0.1975 T

Therefore, the magnetic field strength required to bend alpha particles to a circular path of radius r=0.14 m is 0.1975 T.

To know more about alpha particles, visit:

https://brainly.com/question/15087470

#SPJ11

Can someone please help me

Answers

The Melting of ice cream is a physical change. Explosion of fire works is a chemical change. Rusting of a car is a chemical change. Making an Oragami bird and dissolving are  physical changes  

What is a physical and a chemical change?

A physical change is a change in the physical properties of a substance that does not alter its chemical composition. Examples of physical changes include changes in state (solid, liquid, gas), changes in shape or size, changes in color, and changes in density or texture. Physical changes are usually reversible and do not involve the formation of new substances.

A chemical change, on the other hand, is a change in the chemical composition of a substance that results in the formation of one or more new substances with different chemical properties.

Other answers;

The circle D contains a mixture of molecules

Boiling water is not a chemical change since no new substance is formed.

Learn more about chemical change:https://brainly.com/question/23693316

#SPJ1

according to the big bang theory, why do we live in a universe that is made of almost entirely of matter rather than antimatter?

Answers

According to the big bang theory, we live in a universe that is made of almost entirely of matter rather than antimatter because of a slight excess of matter over antimatter that occurred during the early universe.

This excess is thought to be due to a process called baryogenesis, which involves the production of baryons (such as protons and neutrons) from an initial state of pure energy during the first fractions of a second after the big bang.

The exact mechanism by which baryogenesis occurred is not well understood, but several possible theories have been proposed, including the idea that it is related to the violation of CP symmetry (which refers to the combination of charge conjugation and parity) in the early universe.

In any case, the slight excess of matter over antimatter meant that when matter and antimatter particles collided and annihilated each other during the early universe, there were more matter particles left over, which eventually led to the formation of the structures we see in the universe today.

For more question on big bang theory click on

brainly.com/question/29014839

#SPJ11

a 9v battery is connected across two large parallel plates that are separated by 5.5 mm of air, creating a potential difference of 9.0 v between the plates. calculate the magnitude of the electric force, fe, on an electron at the negative plate.

Answers

The magnitude of the electric force on an electron at the negative plate is [tex]2.62 x 10^-16 N[/tex].

When a 9V battery is connected across two parallel plates separated by 5.5 mm of air, it creates an electric field between the plates, which in turn exerts a force on any charged particle placed in the field. To calculate the magnitude of the electric force on an electron at the negative plate, we first use the formula E = V/d to find the electric field strength. Substituting the given values, we get [tex]E = 1.64 x 10^3 N/C[/tex]. Then, using the formula F = qE, where q is the charge of an electron, we get the magnitude of the electric force as [tex]2.62 x 10^-16 N[/tex], with a negative sign indicating an attractive force towards the positive plate.

learn more about electric force here:

https://brainly.com/question/2526815

#SPJ4

Are the processes that preserved fossils in the rock layers still happening today?

Answers

The impression of a leaf in soft mud may harden into a fossil over time. So, yes, the processes that preserved fossils in rock layers are still happening today.

Yes, the processes that preserved fossils in the rock layers are still happening today.What are fossils?Fossils refer to the remains of ancient plants and animals that are preserved in rock layers. They can be used to learn about the evolution of life on earth and the geological history of the planet.The processes that preserved fossils in rock layers include sedimentation, mineralization, carbonization, and trace fossilization. These processes are still happening today, and new fossils are being formed as we speak. For example, a dead animal that sinks to the bottom of a lake or ocean may be buried by sediment over time, leading to fossilization.

Learn more about  fossils here:

https://brainly.com/question/19649360

#SPJ4

A piece of copper (0.2 kg) is heated to 90°C and then lowered into a beaker of 2 kg of water which is at 20°C.

What is the temperature of the system once it reaches equilibrium?

Specific heat capacity of copper = 8960 J/kg °C
Specific heat capacity of water = 4200 J/kg °C

A:
32.3°C
B:
42.3°C
C:
4.23°C
D:
323°C

Answers

Answer: the answer is a

Explanation:

An energy transfer is shown below.

What type of energy transfer is shown in this image?

electrical to mechanical

chemical to mechanical

chemical to electrical

electrical to chemical

Answers

This image illustrates the transition of electrical energy into chemical energy.

What is an instance of electrical to molecular conversion?

The process of converting electrical energy into molecular energy is called electrolysis of water. Through the use of an exterior current, hydrogen gas is being separated from water. The DC power source is connected to two inert electrodes—such as platinum or indium—that are submerged in water to perform water electrolysis.

How does electrical energy become molecular energy?

Electrolysis is the process of converting electrical energy to molecular energy. When electrical energy is supplied from outside sources, an electrochemical reaction called electrolysis is set in motion.

To know more about energy  visit:-

https://brainly.com/question/8306722

#SPJ1

Right now, my biggest challenge in developing information literacy is...

Ill know that I've overcome this challenge when I am able to...

Intention

By the time I finish this course, I intend for my score on the Information Literacy section of the Discovery Wheel to be...

To overcome my biggest challenge in developing information literacy, I will..

Action

To act on my intentions, I will adopt the following habits:

Answers

We can see here completing the sentences, we have:

Right now, my biggest challenge in developing information literacy is understanding how to effectively evaluate sources for accuracy and reliability.

I'll know that I've overcome this challenge when I am able to confidently and consistently identify trustworthy sources of information and explain my reasoning for doing so.

What is information literacy?

Information literacy refers to the ability to identify, locate, evaluate, and effectively use information from a variety of sources. It involves a set of skills and competencies that enable individuals to effectively navigate the vast amounts of information available in today's digital age.

Continuation:

By the time I finish this course, I intend for my score on the Information Literacy section of the Discovery Wheel to be significantly higher than it is currently.

To overcome my biggest challenge in developing information literacy, I will practice evaluating sources regularly and seek feedback from peers and instructors.

To act on my intentions, I will adopt the following habits: regularly fact-checking information before accepting it as true, seeking out multiple sources to corroborate information, and utilizing critical thinking skills to evaluate the credibility of sources.

Learn more about  information literacy on https://brainly.com/question/682500

#SPJ1

by what percent has the cubic term increased the work over what would be needed to compress an ideal spring?

Answers

The cubic term increases the work needed to compress an ideal spring by: 66.67 percent.

How does the cubic term affect the work done in compressing an ideal spring?

The work required to compress an ideal spring is given by the equation W = (1/2)kx².
The cubic term, which is usually ignored in the linear force-extension equation, is introduced into the equation for work done because the spring's potential energy increases non-linearly as it is compressed.

The equation for work done on an ideal spring that takes into account the cubic term is:
W = (1/2)kx² + (1/3)kx³.From the above equation, it can be seen that the work done is increased by the cubic term.

The question is asking by what percentage the cubic term increases the work done over what would be needed to compress an ideal spring without the cubic term.
Here is the calculation: If we take out the cubic term from the above equation, we get W = (1/2)kx².
So the difference is (1/3)kx³, which is the contribution of the cubic term to the work done.
The percentage increase is given by:(0.333kx³ / 0.5kx²) x 100% = 66.67%

To know more about "Ideal spring" refer here:

https://brainly.com/question/26923303#

#SPJ11

What is the work done on the box from x = 0m to 10m?

Answers

The force applied to the box multiplied by 10m equals the work performed on the box from x = 0m to 10m.

The work done on the box from x = 0m to 10m is the product of the force applied on the box and the displacement of the box. The work done is calculated as:

Work = Force × Displacement

Therefore, the work done on the box from x = 0m to 10m is:

Work = Force Applied × (10m - 0m)

work = Force Applied × 10m

Therefore, the work done on the box from x = 0m to 10m is equal to the force applied on the box multiplied by 10m.

learn more about work done Refer:brainly.com/question/30073908

#SPJ1

which sentence most accurately describes electrically charged objects? (2 points) group of answer choices they are attracted to one other without coming into contact. they are negatively charged objects that are attracted to each other. they attract or repel other charged objects without touching them. they attract other objects after they have been in contact with them.

Answers

Electrically charged objects attract or repel other charged objects without touching them. This is due to the force of attraction or repulsion between charged objects, which depends on their charges and the distance between them.

Electrically charged objects attract or repel other charged objects without touching them accurately describes electrically charged objects.

Electrically charged objects are those that have an imbalance of positive or negative charge.

These objects are either positively charged, meaning they have lost electrons, or negatively charged, meaning they have gained electrons. These charged objects can attract or repel other charged objects without touching them.

The force of attraction or repulsion between two charged objects is known as electric force.

The direction and strength of this force depend on the charges of the objects and the distance between them. Like charges (positive-positive or negative-negative) repel each other, while opposite charges (positive-negative) attract each other.

Electrically charged objects play an important role in many scientific and technological applications.

For example, the principles of electric charge are used in electrostatic precipitators to remove pollutants from the air, in the design of particle accelerators, and in the function of batteries and electrical circuits.

For similar question on electric force.

https://brainly.com/question/30236242

#SPJ11

a bycle with 24-inch diameter wheelsi s travelling at 15mi/h. find the angular speed of the wheels in rad/min. how many revolutions per minute do the wheels make g

Answers

A bycle with 24-inch diameter wheels is travelling at 15mi/h. The angular speed of the wheels is 1319.2 rad/min.
The wheels make 210 revolutions per minute.


The first part of the question is asking for the angular speed of the wheel which is expressed in rad/min. The angular speed is defined as the rate at which an object changes its angle with respect to a fixed point.

The angular speed can be calculated using the formula:ω = v/r Where;ω = angular velocity, v = linear velocity, r = radius of the wheel

Let’s convert the speed given in miles/hour to meters/minute.

The conversion factor for miles to meters is 1 mi = 1609.34 m, and for hours to minutes is 1 hr = 60 min.15 mi/h = 15 × 1609.34 m/60 min = 402.34 m/min

The radius of the wheel is half of the diameter; r = 24/2 = 12 inches.

To convert inches to meters, we multiply by a conversion factor of 0.0254 m/inch.

Therefore; r = 12 × 0.0254 m/inch = 0.3048 m

Now, let’s substitute the values into the angular velocity formula; ω = v/r = 402.34 m/min/0.3048 m = 1319.2 rad/min

To calculate the number of revolutions per minute the wheels make, we can use the formula ;f = ω/2π Where; f = frequencyω = angular velocity = 1319.2 rad/min2π = 6.28f = 1319.2/6.28 = 210 revolutions/min

To know more about "Angular speed" refer here:

https://brainly.com/question/29058152#

#SPJ11

Craters on planet surfaces are the result of impacts by large objects such as asteroids and comets. The impact of a 10 km diameter asteroid that struck Earth 65 million years ago is believed to have caused the mass extinction of over 70 percent of all living species at that time. Place these results in sequence as they occurred. Items in order Items (5 items) (Drag and drop into the appropriate area) Farliest event (Drag and drop into the appropriate area) Earliest event Existing species die from hostile conditions. The atmosphere clouds with dust and debris. Asteroid impact creates a crater, New species evolve in ecological niches. Firestorms sweep the planet.

Answers

From soonest to most recent: The globe is burned up by firestorms, an asteroid strike creates a crater, the atmosphere is clouded with dust, existing species perish due to the harsh environment, and new species emerge in ecological niches.

Because water is essential to life on Earth, scientists seek for it to point to potential habitats. Since these stars are long-lived enough for life to start and develop, astronomers believe that intelligent life is far more probable to exist in the vicinity of stars of types F, G, K, and M.

Astronomers can arrange their probabilistic thinking using the Drake equation. Since it can form lengthy chains that contain numerous additional atoms, carbon is a good building block for life.

To know more about potential click here

brainly.com/question/9605409

#SPJ4

how can the doppler method be used to estimate the average orbital distance of a planet's orbit? question 29 options: a) by measuring the asymmetries in the velocity curve b) by measuring the amount by which the starlight is reduced when the planet transits c) by measuring the time it takes for the star's line-of-sight velocity to cycle from peak to peak, and using newton's version of kepler's third law d) by measuring the speed at which the star orbits the mutual center-of-mass of the star and planet, and using newton's theory of gravity

Answers

The Doppler method can be used to estimate the average orbital distance of a planet's orbit by measuring the time it takes for the star's line-of-sight velocity to cycle from peak to peak, and using Newton's version of Kepler's third law. Option c) is correct .

If a planet orbits a star, both of them revolve around their mutual center-of-mass. This center-of-mass is very close to the star's center since stars are much more massive than planets. As a result, if the star and planet orbit each other, they appear to move in small circles or ellipses around a fixed point.In the Doppler method, astronomers observe the motion of a star, which can reveal the presence of an exoplanet.

When a planet orbits a star, the star moves slightly as a result of the gravitational tug of the planet. This motion causes the star's spectrum to shift slightly towards longer wavelengths (redshift) and shorter wavelengths (blueshift) as the star moves away from and towards us respectively. The size of this shift depends on the mass of the planet and its orbital distance from the star.

By measuring the size of these shifts, astronomers can infer the presence of an exoplanet and estimate its mass and orbital distance. Hence option c) Is correct ,

To know more about Doppler method refer here :

https://brainly.com/question/1330077

#SPJ11

Please assist me with this question.

Answers

The diagram of a thermocouple that can be used to measure the temperature of the sulfur as it cools, created with MS Word is attached.

What is a thermocouple?

A thermocouple is a device that consists of two different types of metal wires joined together at one end. When the junction of the two metals are heated or cooled, a voltage is produced that can be correlated to temperature. Thermocouple are commonly used to measure temperature in a variety of applications because they are rugged, inexpensive and can measure a wide range of temperatures.

To use a thermocouple to measure the temperature of molten sulfur in a beaker, you would need to insert the junction (the end where the two metal wires are joined) into the molten sulfur. The other ends of the metal wires would need to be connected to a device that can measure the voltage produced by the thermocouple. As the sulfur cools and its temperature changes, so will the voltage produced by the thermocouple. By measuring this voltage and using a reference table or equation that correlates voltage with temperature for that specific type of thermocouple, the temperature of the sulfur as it cools can be determined.

Please find attached the drawing of a thermocouple which can be used to determine the sulfur as it cools.

Learn more on temperature measuring devices here: https://brainly.com/question/30246279

#SPJ1

how many time greater is the force of gravity on a 3 kg object lying on the surface of a moon than on a 3 kg object orbiting at a distance of three moon radii above the surface

Answers

The force of gravity on a 3 kg object lying on the surface of a moon is 6 times greater than on a 3 kg object orbiting at a distance of three moon radii above the surface.

What is gravity?

Gravity is the attractive force between two objects. The gravitational force between two objects is proportional to the product of their masses and inversely proportional to the square of the distance between their centers. The formula for the gravitational force is F = G(m1m2/r^2), where F is the force, m1 and m2 are the masses of the objects, r is the distance between the objects, and G is the gravitational constant.

How many time greater is the force of gravity on a 3 kg object lying on the surface of a moon than on a 3 kg object orbiting at a distance of three moon radii above the surface?

The formula for the gravitational force is:

F = G(m1m2/r^2)

The force of gravity on the surface of a moon is:

F = G(m1m2/r^2) = (6.67430 × 10^-11 N m^2/kg^2) (7.342 × 10^22 kg) (3 kg) / (1.7371 × 10^6 m)^2F = 44.72188 N

The force of gravity on a 3 kg object orbiting at a distance of three moon radii above the surface is:

F = G(m1m2/r^2) = (6.67430 × 10^-11 N m^2/kg^2) (7.342 × 10^22 kg) (3 kg) / (1.7371 × 10^6 m * 3)^2F = 7.45365 N

Thus, the force of gravity on a 3 kg object lying on the surface of a moon is 6 times greater than on a 3 kg object orbiting at a distance of three moon radii above the surface.

Here you can learn more about force of gravity

https://brainly.com/question/13634821#

#SPJ11  

What is the cutoff (threshold) frequency for a metal surface that has a work function of 5.42 eV? (1 eV = 1.60 × 10-19 J, h = 6.626 × 10-34 J ∙ s)
A) 1.31 × 1015 Hz
B) 2.01 × 1015 Hz
C) 3.01 × 1015 Hz
D) 5.02 × 1015 Hz
E) 6.04 × 1015 Hz

Answers

Explanation:

The cutoff (threshold) frequency for a metal surface that has a work function of 5.42 eV is given by the formula f0 = (φ/h) × (1/e),

where φ is the work function of the metal, h is the Planck's constant, and e is the charge of an electron.1

eV = 1.60 × 10-19 J, h = 6.626 × 10-34 J ∙ sHere,φ = 5.42 eV = 5.42 × 1.60 × 10-19 Jh = 6.626 × 10-34 J ∙ se = 1.60 × 10-19 C

Thus, the cutoff frequency is:f0 = (φ/h) × (1/e) = (5.42 × 1.60 × 10-19 J)/(6.626 × 10-34 J ∙ s) × (1/1.60 × 10-19 C)≈ 1.31 × 1015 Hz

Therefore, the cutoff (threshold) frequency for a metal surface that has a work function of 5.42 eV is 1.31 × 1015 Hz. The answer is A) 1.31 × 1015 Hz.

To know more about Threshold frequency here :

https://brainly.com/question/726252

#SPJ11

Other Questions
One pump can fill a swimming pool in 4 hours. A second pump can fillthe pool in 6 hours. If the pool starts empty, what part of the pool will befilled in each situation?The first pump works for 2 hours and the second pump works for 3hours.Pls help HELPhat is the approx. volume of the figure (Use 3.14 for pi) the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA Review of rsums is most valid when the content of the rsums is evaluated in terms of the elements of a job description. true/false What is transport in humans and plants and what is the difference? Which graph represents the solution to inequality which atomic particles are in a unique cloud outside of the nucleus of the atom? HELPPPPPPPPPPPP Plsss Solve 4^-2x 4^x = 641) Rewrite the equation using the same base. 2) Solve for x. Remember to show all work.PLEASE SHOW ALL WORK FOR BRAINLIEST PLEASEEE A buffer solution is prepared by adding NaH2PO4 to a solution of H3PO4. What happens if KOH is added? (1 point) one of the one-way functions used in public key cryptography is integer multiplication/factorization. multiplying two integers is easy, but factoring is hard. the number 3174277 is the product of two primes.what is the smaller of the two primes?what is the largest of the two primes? the second punic war a. saw the eventual victory of carthage over rome. b. saw hannibal invade italy from greece. c. won spain for rome and resulted in roman control over the western mediterranean. d. produced a great victory for the romans over hannibal at the battle of cannae. e. all of the above since conforming loans can be much more readily bought and sold in the secondary mortgage market, they carry a(n) interest rate than comparable nonconforming loans. a. higher b. equal c. more volatile d. lower PLEASE HELP WITH THESE TWO QUESTION 20 POINTSSSS Find the Value of X for 3, 4, 5, and 6, and tell whether or not these angles are adjacent or vertical. Remarkable identity fegley, incorporated, has an issue of preferred stock outstanding that pays a $5.60 dividend every year, in perpetuity. if this issue currently sells for $80.40 per share, what is the required return? cuvier's view that the extinction and the subsequent appearance of different creatires could be explained by a series of disasters and re-creations is called true or false: the product life-cycle theory suggests that mature industries tend to shift production out of the united states and into low-cost assembly locations.