8. Which modern change had the most impact on a traditional
practice, process, or idea?

Answers

Answer 1

One modern change that has had a significant impact on a traditional practice, process, or idea is the internet's proliferation and the widespread use of digital technology.

Which modern change had the most impact on a traditional practice, process, or idea?

The internet has revolutionized the way we communicate, work, learn, and conduct business. It has changed the way we consume media, connect with people, and access information.

For example, traditional forms of media, such as newspapers and magazines, have seen a decline in readership as people increasingly rely on online sources for their news and information.

Digital technology has also transformed industries such as music and publishing, allowing artists and authors to reach wider audiences and disrupting traditional distribution channels.

The internet has also challenged traditional ideas about privacy and security, raising new concerns and opening up new areas of debate. Overall, the impact of the internet and digital technology has been profound and far-reaching, affecting almost every aspect of modern life.

Learn more about Technology here

https://brainly.com/question/1065537

#SPJ9


Related Questions

The woman's right movement in the United States was first started by a woman who

Answers

Answer:

Elizabeth Cady Stanton

Explanation:

Choose two of the countries you researched and answer the following question.

How were these countries (Japan and Germany) approaches to the Great Depression similar?

Answers

Both Japan and Germany responded to the Great Depression with a combination of government intervention, protectionist measures, and public works projects aimed at stimulating economic growth and reducing unemployment.

How did Germany and Japan approached the great depression?

Both Japan and Germany experienced significant economic downturns during the Great Depression and responded in similar ways to address the crisis.

In Japan, the government implemented a series of economic policies known as the "Showa Restoration" aimed at stimulating economic growth and promoting industrialization. These policies included massive public works projects, subsidies for heavy industry, and protectionist measures to limit imports and promote domestic production. The government also took control of the banking system and implemented a range of measures to stabilize prices and support the agricultural sector.

Similarly, Germany responded to the Great Depression with a range of economic policies aimed at stimulating growth and reducing unemployment. The government implemented a series of public works projects, including the construction of highways and public buildings, and increased spending on education and research. Additionally, the Nazi government implemented protectionist trade policies and increased government control over the economy, including the nationalization of key industries such as steel and coal.

Learn more on great depression here;

https://brainly.com/question/20513444

#SPJ1

How was the system of government of Athens different from the system of government of the United States?

Athens had an oligarchy in which several wealthy people ruled the government, while the United States is a republic in which all its citizens take part in government.
Athens had an alliance system that gave all members a voice in the government, while the United States has a democratic system that elects officials to make decisions.
Athens had an indirect democracy that allowed all citizens to take part in government, while the United States has a direct democracy in which people vote for representatives.
Athens had a direct democracy because all citizens took part in government, while the United States has an indirect democracy in which the citizens elect representatives. ILL GIVE BRAINLYIST AND 40 POINTS

Answers

The correct answer is: Athens had a direct democracy because all citizens took part in government, while the United States has an indirect democracy in which the citizens elect representatives

Answer:

the answer is Athens had a direct democracy while the umUS is indirect, citizens elect representatives.

What organization did they establish ?

Answers

The organization established by the Abolition movement was The American Anti-Slavery Society.

What was the Abolition movement ?

The Abolition movement was a social and political movement in the United States in the 18th and 19th centuries that sought to end slavery and the slave trade. The movement included a variety of organizations and individuals who worked towards this goal, including the American Anti-Slavery Society, founded in 1833 by William Lloyd Garrison and other abolitionists.

The American Anti-Slavery Society was one of the largest and most influential organizations of the Abolition movement. Its members included both white and black Americans who worked towards the abolition of slavery through a variety of tactics, including petitions, pamphlets, speeches, and civil disobedience.

Find out more on the Abolition movement at https://brainly.com/question/15907703

#SPJ1

First part of the question is:

What was the Abolitionist movemnet and What organization did they establish ?

Hi there, I need a little help for this question!

Answers

Answer:

The Crusades were organized by western European Christians after centuries of Muslim wars of expansion. Their primary objectives were to stop the expansion of Muslim states, to reclaim for Christianity the Holy Land in the Middle East, and to recapture territories that had formerly been Christian. Many participants also believed that undertaking what they saw as holy war was a means of redemption and a way of achieving expiation of sins.

help rn pls thx
Which of the following was a major question of Reconstruction?

Answers

The central question of Reconstruction was C. How to reinstitute slavery?

What was the primary outcome of the Reconstruction?

Amοng the several triumphs οf Recοnstructiοn were the Sοuth's first state-funded public educatiοn systems, mοre equal taxatiοn legislatiοn, anti-racial discriminatiοn statutes in public transpοrtatiοn and lοdging, and ambitiοus ecοnοmic develοpment prοgrammes (including resοurce tο railrοads and different enterprises).

Which οf the fοllοwing was the primary gοal οf Recοnstructiοn?

The Civil War ended in 1865, and the Recοnstructiοn Era began in 1877. Its principal fοcus was οn restοring the sοuthern states tο full pοlitical invοlvement in the Uniοn, ensuring the rights οf freed slaves, and establishing new cοnnectiοns between African Americans and whites.

To know more about Reconstruction visit:

brainly.com/question/1286522

#SPJ1

Where did the Chisholm Cattle Trail lead to? Explain why it went there.

Answers

Answer:

The Chisholm Cattle Trail was a popular route used during the late 1800s to transport cattle from ranches in Texas to railheads in Kansas. The trail was named after Jesse Chisholm, a trader who had established trading posts and a network of trails throughout the region.

The Chisholm Cattle Trail started in South Texas near the town of San Antonio and extended northward for approximately 800 miles through Indian Territory (now Oklahoma) to the railheads in Kansas. The trail passed through many towns and cities, including Wichita and Abilene, which were important railroad centers at the time.

The reason the Chisholm Cattle Trail was used was because it provided ranchers in Texas with a direct route to the railheads in Kansas where they could sell their cattle for a higher price than they could get in Texas. The trail also provided an efficient way to transport large numbers of cattle over long distances. The trail was well-established and well-marked, making it easier for cowboys to navigate with their herds.

In addition to its economic benefits, the Chisholm Cattle Trail also played an important role in shaping the culture of the American West. The trail was used by many legendary figures of the Old West, including cowboys, ranchers, and outlaws. It was also the inspiration for many works of literature and film that romanticized the cowboy way of life.

Today, the Chisholm Cattle Trail is recognized as an important part of American history and is commemorated with markers and historic sites along its route.

Explanation:

What was courting like in Europe in the 1300s?

Answers

Answer:

Courting practices in Europe in the 1300s varied depending on social class and geographical location. However, some general practices were common across the continent during this time period.

For the upper classes, courting was often formal and structured, with clear expectations and protocols. Men would often send letters or gifts to women they were interested in courting, and these women would respond in kind. Courtship was often overseen by parents or other family members, and marriages were frequently arranged for political or economic reasons.

In the middle and lower classes, courtship was less formal and often began with young people meeting each other at social events or through friends. Couples would go for walks, attend church together, or engage in other activities that allowed them to get to know each other. Courtship was often a lengthy process, and couples might spend years courting before getting married.

In some regions, courtship involved a series of rituals and customs. For example, in parts of Germany, young men would carve wooden spoons for the women they were courting, while in parts of France, men would give their partners a kiss on each cheek to signify their affection.

Overall, courting in Europe in the 1300s was often a structured and formal process, with clear expectations and rituals for couples to follow. However, the exact practices varied depending on social class, geographical location, and cultural traditions.

Explanation:

Affective of world War 1

Answers

The First World War destroyed empires, created numerous new nation-states, encouraged independence movements in Europe's colonies, forced the United States to become a world power and led directly to Soviet communism and the rise of Hitler

Tell the story of the Berlin Wall (from the wall going up to the wall coming down). This will consist of 7 Sections. The 7 sections will contain part of the story of the wall (2-3 sentences/bullet points). Research the items that you fell need to be included to “tell the story”.

Answers

The Berlin Wall was erected in August 1961 by the German Democratic Republic (GDR), a communist state that controlled East Germany.

When was Berlin Wall built and why?

Soviet leader Nikita Khruschev suggested to East Germany that it block off access between East and West Berlin in order to stop the exodus to the West. More than 30 miles of barbed wire fencing were installed through the center of Berlin by East German soldiers on the night of August 12–13, 1961.

The wall separated the city of Berlin into two parts: East Berlin, which was controlled by the Soviet Union, and West Berlin, which was controlled by the Western powers of the United States, Great Britain, and France. The purpose of the wall was to prevent the people of East Berlin from fleeing to the West.

Learn more about The Berlin Wall here:

https://brainly.com/question/19520457

#SPJ1

The German Democratic Republic (GDR), an East German communist state, built the Berlin Wall in August 1961.

What was the Berlin Wall?

Berlin Wall From 1961 to 1989, a fortified concrete and wire wall divided East from West Berlin. To prevent East Berliners from emigrating to the West, the authorities of what was then East Germany constructed it.

During the Cold War, the German Democratic Republic constructed the Berlin Wall to stop its citizens from fleeing Soviet-controlled East Berlin and moving to West Berlin, which the main Western Allies governed.

It created two starkly different areas within Berlin in terms of geography and ideology.

The Berlin Wall's goal was to prevent Western "fascists" from entering East Germany and weakening the socialist state, but its main goal was to stop large-scale East-to-West migration.

Learn more about the Berlin Wall here:

https://brainly.com/question/19520457

#SPJ1

Excerpt taken from The Historic Rise of Old Hickory by Suzanne B. Williams

Four major candidates ran in the 1824 election, all under the "Democratic-Republican" name. One of the candidates, Andrew Jackson, was already famous. In the 1780s, he earned the right to practice law and served in various offices of the state government, including senator. He earned the nickname "Old Hickory" for his toughness as a general during the War of 1812 and First Seminole War. Jackson supported slavery and "Indian removal." This earned him support from voters in southern and frontier states. The other three candidates were John Quincy Adams of Massachusetts, Henry Clay of Kentucky, and William Crawford of Georgia.

U.S. presidents are elected through the Electoral College. The Founding Fathers worried that Americans were too spread out to learn enough about the candidates. Under the Electoral College, Americans cast their ballot for the popular vote, which chooses the electors for each state. The number of electoral votes each state equals the number of representatives and senators combined. The candidates must win an absolute majority of electoral votes to win the election.

In 1824, Andrew Jackson won the popular vote, but he did not win it in each state. Jackson and Adams both won many electoral votes. Jackson won the most with 99. However, a candidate needs an absolute majority of electoral votes to win. In 1824, Jackson needed 131 to win. When there is not majority winner, the election goes to the House of Representatives. This has only happened twice in U.S. history.

Even though he won the popular vote and many electoral votes, Andrew Jackson lost the presidency in 1824. John Quincy Adams was the Secretary of State at this time. Henry Clay was the Speaker of the House of Representatives. Henry Clay, receiving the least, was left out. However, as a leader in the House of Representatives, he had influence over the other members. Clay openly hated Jackson and there were rumors that Clay made a deal with Adams in exchange for his support. The House election declared John Quincy Adams president. Soon, he chose Henry Clay to fill the seat he left vacant, Secretary of State. Jackson was shocked and enraged. Although there was no inquiry of possible wrongdoing, Jackson accused Adams and Clay of making a "corrupt bargain."

John Quincy Adams was a disappointment as president. Many of his goals created divisions like federal funds for internal improvement. Some states thought that taking federal funds would force them to follow certain rules. They felt this reduced their rights as independent states. Jackson took advantage of issues like this one to gather more support. More Jackson supporters found their way to seats in Congress. He was as a man of the people and said Adams could never understand the common man’s concerns.

John Quincy Adams ran against Andrew Jackson in the 1828 election. Personal attacks grew even more vicious, but Andrew Jackson appealed to many. He believed government was for the common man. He believed in strict reading of the law and limited internal improvements. He also believed in states’ rights.

Andrew Jackson easily won the 1828 election, winning both the popular vote and a majority of electoral votes. Historians note the sectional nature of the voting. Support for Jackson was concentrated in South while Adams’ support was mostly in the North. Jackson was so popular because he brought changes to the government. He also wanted to make sure the government was responsible for its actions. Jackson pushed settlement into the frontier. He supported the Indian Removal act. He also defended the spread of slavery. Though his support was heavier in the South, he was determined to keep a unified nation. The rise and presidency of Old Hickory is memorable to Americans today.


Which of the following did Andrew Jackson not support?

A limited national government
Spreading of slavery to the frontier
Federal funds for internal improvements
A strict interpretation of the U.S. Constitution

Answers

C) Jackson was against powers that were granted solely for profit, but he was in favor of a limited national government. The subject of interest if an explicit grant existed, and he opposed federal funds for internal improvements.

What ideals did Andrew Jackson hold?

While Jackson was a supporter of states' rights and a strict interpretation of the Constitution, he was of the opinion that the federal government had to rule supreme whenever the Constitution delegated power to it. Jackson also valued the Union and was opposed to its compromise or dissolution.

What specific actions did Andrew Jackson take?

Jackson established the foundation for democracy, paid off the nation's debt, acquired new lands for the United States, improved relations with other nations around the world, and introduced a new currency.

To learn more about federal funds here:

https://brainly.com/question/29761058

#SPJ1

what were the negative effects that his trade had on the societies at africa​

Answers

Answer: The Atlantic slave trade had a negative impact on African societies and the long-term impoverishment of West Africa.

Explanation:

The Atlantic slave trade had a negative impact on African societies and the long-term impoverishment of West Africa. For some it intensified effects already present among its rulers and kingdoms. Between the 1680s and the 1780s the value of Africa's Atlantic trade rose six-fold.

Answer:

The slave trade had devastating effects in Africa. Economic incentives for warlords and tribes to engage in the slave trade promoted an atmosphere of lawlessness and violence. Depopulation and a continuing fear of captivity made economic and agricultural development almost impossible throughout much of western Africa

Which of Truman's Fair Deal proposals did Congress pass?

a
federal aid to education

b
repeal of the Taft-Hartley Act

c
an increased federal minimum wage

d
strong civil rights laws

Answers

Congress passed Truman's proposal for an increased federal minimum wage as part of his Fair Deal. This raised the federal minimum wage from forty cents to seventy-five cents per hour. The other proposed elements of the Fair Deal, such as federal aid to education and strong civil rights laws, were not passed by Congress at that time but would eventually be implemented in later years.

Which approach to achieving civil rights is demonstrated in the Florida headline

Answers

Florida was home to pioneering activists such as Mary McLeod Bethune and James Weldon Johnson, as well as C.K. Steele and Patricia Stevens Due, who carried the torch in the 1950s and 1960s. The struggle for civil rights is a dramatic and compelling aspect of Florida history."

PLEASE HELP!!!
Discussion Topic
In this unit, you learned about the federal bureaucracy and public policy, including fiscal
policy, in the country. Based on what you learned in the lesson, what are some of the
largest expenditures the federal government is responsible for? One of the most
divisive political issues in our nation has been the government's approach to spending.
Think about some of the things that government spends money on. If you had to make
changes to spending, what would you do? Why? What might be some short-term and
long-term effects of your proposed changes? Be sure to use facts and examples to
support your answer.

Answers

Answer: One of the largest expenditures of the federal government is on social security and healthcare programs, such as Medicare and Medicaid. These programs are meant to provide support and medical assistance to the elderly, disabled, and low-income individuals. The government also spends a significant amount of money on national defense, including military operations and defense research and development.

When considering changes to government spending, it is important to weigh the potential benefits and drawbacks of each proposal. One approach could be to reevaluate the military budget, which makes up a large portion of the federal budget. While maintaining a strong national defense is important, there may be opportunities to reduce spending in certain areas, such as military equipment and overseas operations, and redirect those funds towards other priorities, such as healthcare and education.

Another area where changes could be made is in government subsidies and tax breaks for large corporations. While these policies are meant to encourage economic growth and job creation, they often benefit only a small percentage of the population and can lead to increased income inequality. Reallocating funds from these programs to social welfare and education programs could provide more widespread benefits to the American people.

Short-term effects of these proposed changes may include job losses in certain industries and potential pushback from corporate interests. However, in the long term, such changes could lead to a more equitable distribution of wealth and improved quality of life for all Americans. It is important to note that any proposed changes should be carefully evaluated and implemented over time to minimize negative effects on the economy and society as a whole.

Final answer:

The federal government is responsible for expenditures on healthcare, defense, and social security. Prioritizing spending on education and infrastructure can have short-term and long-term effects on the economy and citizens' well-being.

Explanation:

Some of the largest expenditures that the federal government is responsible for include healthcare (such as Medicare and Medicaid), defense and military spending, and social security. These programs account for a significant portion of the federal budget and are crucial for the well-being and security of the nation.

If I had to make changes to spending, I would prioritize investing in education and infrastructure. By allocating more funds towards improving schools and transportation systems, we can enhance the future prospects of our citizens and stimulate economic growth. These changes could have both short-term and long-term effects. In the short term, there may be increased job opportunities and improved access to quality education. In the long term, a well-educated workforce and efficient infrastructure can lead to sustained economic development and a higher standard of living.

Learn more about Government spending here:

https://brainly.com/question/34317373

#SPJ2

How did rockafeller use horizontal integration?
A. By getting an exclusive government contract
B. By controlling all aspects of the production process
C. By using huge profits to eliminate his competitors
D. By buying out all the competing oil companies

Answers

Answer:

The answer is D) By buying out all the competing oil companies.

Explanation:

Rockefeller used horizontal integration to build the Standard Oil empire by making agreements with railroads. Rockefeller's business was big enough that he could negotiate favorable rates for transporting oil because he was transporting a lot of oil and the railroads wanted his business

Hope this helps!

Please mark as brainlist!

4. United States was granted the Florida territory as a result of
A) the French and Indian War.
B) diplomats and conflict.
C) the Adams-Onis Treaty.
D) the Treaty of Paris.

Answers

Answer: D) The Adams-Onis Treaty

Explanation:

Anti-Federalists believed in strong OA. federal OB. state OC. city D. foreign governments.​

Answers

Answer: D

When it came to national politics, they favored strong state governments, a weak central government, the direct election of government officials, short term limits for officeholders, accountability by officeholders to popular majorities, and the strengthening of individual liberties.

help pls pls pls pls pls

Answers

The issue on the nullification argument by Congress came about as a result of B. The passage of high tariffs by Congress.

How did tariffs lead to the nullification crisis ?

The enactment of high tariffs by Congress was the problem that prompted members of Congress to use the justification that states might void legislation. Early in the 1830s, South Carolina, which was highly dependent on imported products and had been adversely affected by the tariffs, vowed to annul the levies and, if necessary, separate from the Union.

According to the principle of nullification, which Thomas Jefferson and James Madison had advanced in the Kentucky and Virginia Resolutions of 1798, each state had the authority to void any federal legislation they believed to be unconstitutional.

Find out more on the Nullification crisis at https://brainly.com/question/203857

#SPJ1

How did Germany's actions (specifically the invasions of Austria and Czechoslovakia) because WWII? in a R.A.C.E. paragraph.

Answers

Germany's actions in Austria and Czechoslovakia set the stage for the outbreak of World War II, which began in September 1939 with Germany's invasion of Poland.

What is background history?

Germany's actions, specifically the invasions of Austria and Czechoslovakia, were major factors that led to the outbreak of World War II. In 1938, Germany, under the leadership of Adolf Hitler, annexed Austria, violating the Treaty of Versailles and bringing the country under Nazi control. This move was followed by the invasion of Czechoslovakia in March 1939, which led to the occupation and partition of the country.

The annexation of Austria and invasion of Czechoslovakia also undermined the system of collective security established after World War I, which relied on a balance of power among the major European nations. As a result, other European countries, including Britain and France, began to see Hitler as a threat to their national interests and responded with diplomatic protests and military preparations.

Ultimately, Germany's actions in Austria and Czechoslovakia set the stage for the outbreak of World War II, which began in September 1939 with Germany's invasion of Poland.

To know more about Hitler visit:

https://brainly.com/question/12778492

#SPJ1

Which event would eventually lead to the passage of the 1964 Civil Rights Act?

March on Washington

Albany Movement

Atlanta Race Riot

Montgomery Bus Boycott

Answers

The event that ultimately led to the passage of the 1964 Civil Rights Act was the Montgomery Bus Boycott. This protest began in 1955 and lasted until 1956, when city buses were finally racially desegregated. The boycott called attention to racial injustice throughout the United States and helped pave a path for future civil rights legislation such as the 1964 Civil Rights Act.

Destruction resulting from World War II forced the Japanese to rebuild their industrial complexes. How did this affect Japan’s ability to compete in the global marketplace? (NEED ANSWER ASAP!)

Answers

From 1913 to 1918, exports increased by fourfold. Inflation accelerated as a result of the massive influx of capital into Japan and the subsequent industrial boom.

How was Japan's economy affected by World War II?

Due to the aerial bombings, the factories and railroads that survived were defunct, and due to a lack of input, the economy was doomed to fail. There was a food shortage in 1946, one year after Japan gave up its independence. Everyone in families had their food rationed, and there were always black markets. Japan was able to recover from the trauma of World War II despite being severely damaged by the nuclear bombardment of Hiroshima and Nagasaki and other Allied air raids on Japan. By the 1960s, Japan had become the third-largest economic entity in the world, after the United States and the Soviet Union.

To learn more about Japan economy visit:

https://brainly.com/question/13007706

#SPJ1

Can someone please help me? :(

Answers

Answer:

they would eventually be defeated by the sheer numbers arrayed against them.

Explanation:

did this help?

How was Joseph Stalin able to gain power after the death of Vladimir Lenin?

Answers

Answer:

Joseph Stalin was able to gain power after the death of Vladimir Lenin through a combination of factors. Stalin initially held a position in the government as General Secretary of the Communist Party of the Soviet Union but was considered a relatively minor figure in the realm of Soviet politics. However, his behind-the-scenes maneuvering and control of key party positions, his propaganda tactics, and the weakness of his opponents allowed him to consolidate power.

Stalin was able to build up a network of supporters throughout the Communist Party and the Soviet government, which he then used to sideline his rivals. One key factor in Stalin's rise to power was his ability to manipulate factional infighting within the Communist Party. Stalin was able to exploit divisions between different leftist groupings, presenting himself as a moderate consensus builder. Additionally, Stalin's belief in industrialization and collectivization gained him considerable support among the urban proletariat and the peasantry.

In addition to his power within Soviet politics, Stalin utilized propaganda tactics to project an image of himself as the rightful heir to Lenin's legacy. Stalin was able to assert himself as the sole leader of the Soviet Union, and any opposition to his rule was seen as opposition to the Communist Party and the Soviet state.

In summary, Stalin was able to gain power after Lenin's death by building a network of loyal supporters, manipulating party factions, appealing to the working class, and projecting himself through propaganda as the legitimate successor to Lenin.

What do the USMCA and the European Union have in common?

They both promote English as the language of international trade.
They are both moving toward a political union of their members.
Their member nations reduce tariffs to trade with each other.
They have both decreased in size in recent years.

Answers

the European Union has social goals, whilst USMCA does not. the European Union has political goals, while USMCA does not. the European Union has tariffs, whilst USMCA does not. See what the neighborhood says and unlock a badge.

What are three advantages of common markets like NAFTA now USMCA and EU?

Key Takeaways. Some of the superb consequences of NAFTA had been multiplied trade, monetary output, foreign investment, and better customer prices.

The USMCA Intellectual Property (IP) Chapter provides robust and tremendous protection and enforcement of IP rights quintessential to using innovation, developing monetary growth, and helping American jobs, inclusive of the highest requirements of protection for change secrets and techniques of any prior U.S. FTA.

Learn more about USMCA Intellectual Property here:

https://brainly.com/question/30414995#SPJ1

Answer:

Their member nations reduce tariffs to trade with each other.

Explanation:

What were the causes of England's population growth in the 1800s and what consequences do you think
this population growth had on the country?

Answers

England experienced significant population growth in the 1800s due to a combination of factors, including:

Improved living conditions: Improvements in sanitation, healthcare, and food production led to a decrease in infant mortality rates and an increase in life expectancy, which contributed to population growth.

Urbanization and industrialization: The growth of cities and the industrial revolution led to increased job opportunities, which in turn attracted people from rural areas to urban centers.

What is population growth?

Generally, The rise in the total number of persons who are part of a population or scattered group is referred to as population growth. The actual quantity of yearly human population increase is around 83 million, which corresponds to an annual growth rate of 1.1%.

The population of the world has increased from one billion in the year 1800 to 7.9 billion in the year 2020. Wikipedia

Read more about population growth

https://brainly.com/question/18415071

#SPJ1

Which group was the target of the anti-Semitism that Hitler promoted in Germany?

Responses

Jews

Jews

Aryans

Aryans

politicians

politicians

scientists

Answers

Answer: The Jews

Explanation:

Why did policymakers in the Johnson administration report that the incident in the Tonkin Gulf was unprovoked?
They believed Congress would approve a military campaign in South Vietnam without having a formal declaration of war.
They wanted to overthrow Ngo Dinh Diem and his government.
They believed it would cause Vietnam to become a permanent trading partner.
They believed it would unifNorth and South Vietnam as one nation.

Answers

Answer:

Johnson administration policymakers reported that the incident in the Tonkin Gulf was unprovoked in order to gain Congressional approval for a US military campaign in South Vietnam. They needed this approval to carry out their secret plan to overthrow the Ngo Dinh Diem government, while also showing that the US was taking a strong stand against North Vietnam. The administration believed this would increase their chances of gaining Congressional approval and ultimately unifying North and South Vietnam as one nation

Explanation:

In your response, be sure to address all parts of the question. Use complete sentences; an outline or bulleted list alone is not acceptable.
Use the passage to answer all parts of the question that follows.

a) Explain ONE way in which the passage illustrates a response to European colonialism.

b) Explain ONE way in which the circumstances of the speech might have affected the author's argument in the passage.

c) Explain ONE way in which the author's point of view is significant for illustrating how European ideologies influenced the development of Indian society in the nineteenth century.

Now, suppose that all the English and the whole English army were to leave India, taking with them all their cannon and their splendid weapons and everything, then who would be rulers of India? Is it possible that under these circumstances two nations-the Muslims and the Hindus
-could sit on the same throne and remain equal in power? Most certainly not.
The aims and objects of the Indian National Congress are based upon an ignorance of history and present-day realities; they do not take into consideration that India is inhabited by different nationalities; they presuppose that the various religions, castes, and ethnic groups of India can all be treated alike and all of them belong to the same nation. For the successful running of a democratic government, it is essential that the majority should have the ability to govern not only themselves but also unwilling minorities. I consider the experiment that the Indian National Congress wants to make fraught with dangers and suffering for all the nationalities of India, but especially for the Muslims. The Congress cannot rationally prove its claim to represent the opinions, ideals, and aspirations of the Muslims."
Syed Ahmad Khan, Indian Muslim educator and political reformer, speech given before theMuslim community of Meerut in northern India, 1888

Answers

Explanation:

a) The passage illustrates a response to European colonialism by challenging the Indian National Congress's aim of uniting all Indians under one nation, regardless of their differences in religion, caste, and ethnicity. The author, Syed Ahmad Khan, argues that India is inhabited by different nationalities and that the various groups cannot be treated alike. This response reflects the way in which European colonialism had divided and categorized Indian society along religious and caste lines, leading to the fragmentation of the country.

b) The circumstances of the speech might have affected the author's argument in the passage because he was addressing the Muslim community of Meerut in northern India, which was a region with a significant Muslim population. The author, himself a Muslim, was likely trying to appeal to his audience by emphasizing the importance of Muslim interests in the context of Indian nationalism. This might have influenced the way in which he framed his argument, highlighting the potential dangers and suffering that the Indian National Congress's policies could bring to the Muslim community.

c) The author's point of view is significant for illustrating how European ideologies influenced the development of Indian society in the nineteenth century because he was a prominent figure in the movement for Muslim political and educational reform in India. His views were shaped by his encounters with European ideas and institutions, particularly during his travels to Britain. As a result, he became a proponent of modern education for Muslims and argued that they needed to adopt Western ideas and institutions to keep up with the changing world. His views illustrate the ways in which European ideologies influenced Indian thought and the development of Indian society in the nineteenth century

which region of oklahoma is most noted for wheat production forests
plains
mountains
northern plateaus

Answers

The plains is the region of oklahoma which is most noted for wheat production. The Option B is correct.

What location of oklahoma is known for wheat production?

The plains region, also known as the Great Plains, is a vast area of flat land that extends across several states, including Oklahoma, Kansas, Nebraska, and Texas. The region is characterized by its fertile soil, which is well-suited for growing crops such as wheat, corn, and soybeans.

Oklahoma is one of the largest wheat-producing states in the United States, and wheat is one of the state's most important agricultural commodities. The northern plateaus region of Oklahoma is known for its forests, while the mountains region is characterized by its rugged terrain and natural beauty.

Read more about oklahoma

brainly.com/question/25377599

#SPJ1

Other Questions
What is the answer to the question What combination of factors, such as distance, intensity, and duration of exposure could lead applause to negatively impact your hearing?. what was john tagg main idea in why we learn Write the equation. The Iowa candidate got 6 times as many votes as the Ohio candidate. The Ohio candidate got 850 votes. How many votes did the Iowa candidate get? Record yourself giving a performance of as much of "Chatter at a Royal Ball" as you cminutes if you need, and when you are ready, just click on the record button. You canREPLAY.*Note: This is a practice activity. Completing this activity will not only prepare you forimportantly, it will enhance your language ability. This activity will not count towards yo The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3'