(28) CCC Cause and Effect Young's modulus is a measure
of a solid material's stiffness. A highly ductile
material will typically have a very low modulus. The
table shows several different metals, their crystalline
structure, and their Young's modulus. Describe the
pattern you observe and explain the connection
between structure and stiffness.

(28) CCC Cause And Effect Young's Modulus Is A Measureof A Solid Material's Stiffness. A Highly Ductilematerial

Answers

Answer 1

From the table, it is very clear that as the crystallinity increases, its stiffness also increasing. The FCC structures are having less crystallinity and is more ductile than BCC structure.

What is ductility of a material ?

Ductility of a material is the ability to make very thin elongated wires. Whereas, stiffness of a material is the resistance to any elongation or compression.

The more crystalline the material, more will be the stiffens. The material with higher Young's modulus  (Y) are more crystalline and stiff. As Y decreases, stiffness decreases, the material becomes ductile.

Because the body-centered cubic (BCC) lattice is not tightly packed despite being cubic, the face-centered cubic (FCC) crystalline structure has greater ductility than the BCC.

Due to the fact that a hexagonal close-packed (HCP) lattice is densely packed but not cubic, HCP metals are less ductile than BCC and FCC metals.

Find more on ductility:

https://brainly.com/question/22212347

#SPJ9


Related Questions

Please help me with this.

Answers

The number of moles of aluminum chloride that forms when 81g of aluminium reacts is 3 moles.

How to calculate stoichiometry?

Stoichiometry is the study and calculation of quantitative (measurable) relationships of the reactants and products in chemical reactions (chemical equations).

According to this question, aluminium reacts with chlorine to produce aluminum chloride.

Based on the balanced equation, 2 moles of aluminum produces 2 moles of aluminium chloride.

81 g of aluminium is equivalent to 3 moles of aluminum

This means that 3 moles of aluminum chloride will be produced if 3 moles of aluminum reacts.

Learn more about stoichiometry at: https://brainly.com/question/9743981

#SPJ1

How many molecules of 2.21 moles of propane (C3H8)? ​

Answers

Answer: Lebron

Explanation: James was here

A contained sample of hydrogen gas is at 30°C and exerts a pressure of 0.45 atm. What will be the new pressure if the gas cools to -14°C and the volume remains constant?

Answers

Answer: .38 atm

Explanation:

p2= p1 x t2 / t1

0.45 x 259.15 / 303.15

Which stars have the highest absolute brightness?

The HR diagram is shown with Absolute Brightness on the y axis from negative four to six and Surface Temperature on the x axis from 40,000 to 2,500 degrees Celsius. There are several dots plotted between four and six absolute brightness and 10,000 to 2,500 degrees Celsius labeled Supergiants. There are several dots plotted between 1.5 and three absolute brightness and 7,500 to 2,500 degrees Celsius labeled Giants. There are several dots plotted between negative four and negative two absolute brightness and 30,000 to 7,500 degrees Celsius labeled Dwarfs. Down the middle, there are several dots plotted diagonally from ordered pair 40,000 and five down to 2,500 and negative three labeled Main Sequence.

Supergiants
Giants
Yellow stars
Dwarfs

Answers

Answer:Super-giants

Explanation:

A person with type A blood (AO) is crossed with a person with type B blood (BO). Which of the following shows the correct phenotype percentages.

Answers

If a person with type A blood (AO) is crossed with a person with type B blood (BO), the correct genotype percentage is 25% AB, 25% BO 25%AO, and 25% OO while the phenotypes are 25% A, 25% B, 25% AB and 25% O.

What is a punnet square in genetics?

A punnet square in genetics is a useful diagram to estimate the phenotypes in offspring, in this case we have

      A    O

B   AB  BO

O  AO  OO

Therefore, with this data, we can see that the punnet square can be used to estimate phenotypes and thus determine the proportion of offspring.

Learn more about the blood system alleles here:

https://brainly.com/question/3221452

#SPJ1

If the moon is half full on June 15, on approximately what date will it next become full? O A. June 29 O B. June 22 O C. July 14 O D. July 7 SUDIAIT​

Answers

The next full moon will occur around July 14, which is answer choice C.

What is moon ?

The moon is a natural satellite of the Earth, meaning it is a celestial body that orbits the Earth. It is the fifth largest moon in the solar system and is the largest relative to the size of its host planet.

The moon is approximately one-quarter the size of the Earth and is the closest astronomical object to the Earth.

If the moon is half full on June 15, then we can determine the next full moon by adding approximately 29.5 days to June 15, which is the average length of time for the moon to complete a full cycle of phases.

So, the next full moon will occur around July 14, which is answer choice C.

Therefore, option C is the correct answer.

Learn more about moon here : brainly.com/question/650881

#SPJ1

Calculate the total number of ions in 3. 93 mol MgCl2

Answers

The total number of the ions in the 3.93 mol of the MgCl₂ is 7.09 × 10²⁴ ions .

The chemical equation is as follows :

MgCl₂ --->  Mg⁺  +  2Cl⁻

The total number of the ions of  MgCl₂ = 1  Mg⁺ + 2 Cl⁻

The total number of the ions of  MgCl₂ = 3 ions

The number of the moles of the MgCl₂ = 3.93 mol

1 mole of the substance = 6.022 × 10²³ ions

The total number of the moles of substance = 3 × 3.93 × 6.022 × 10²³ ions

The total number of the moles of ions = 7.09 × 10²⁴ ions

Thus, the  total number of  the ions of the  MgCl₂ is 7.09 × 10²⁴ ions .

To learn more about ions here

https://brainly.com/question/5373279

#SPJ4

How many molecules of hydrogen are required to react with 65 molecules of nitrogen?

Answers

Explanation:

Refer to pic...........

When the astronaut took this photo of Earth, what moon phase would have been visible in View from Earth?

Answers

Based on the photo provided, it appears to be a picture of the Earth as seen from space. Unfortunately, I cannot determine the phase of the Moon from this image alone as the Moon is not visible in the photo.

What are the phases of the moon ?

The phases of the Moon are the different appearances of the illuminated portion of the Moon as seen from Earth. There are eight commonly recognized phases of the Moon, which are:

New Moon, Waxing Crescent, First Quarter, Waxing Gibbous, Full Moon

Waning Gibbous, Third Quarter, Waning Crescent

The entire cycle of lunar phases takes approximately 29.5 days to complete, which is known as a lunar month.

Based on the photo provided, it appears to be a picture of the Earth as seen from space. Unfortunately, I cannot determine the phase of the Moon from this image alone as the Moon is not visible in the photo.

The phase of the Moon changes continuously over a period of approximately 29.5 days, so it would be necessary to have a separate photo of the Moon to determine its phase at the time the astronaut took this picture.

To learn more about phases of the moon follow the given link: https://brainly.com/question/4471274

#SPJ1

A student is making a solution of sugar in water. If the student uses 0.55 moles of sugar and enough water to make 908.08 milliliters of solution, what is the molarity of the student's sugar solution?

Answers

Answer:

Molarity is defined as the number of moles of solute per liter of solution. In this problem, we are given the number of moles of sugar and the volume of the solution in milliliters. We first need to convert the volume to liters before we can calculate the molarity.

To convert milliliters to liters, we divide by 1000:

908.08 milliliters = 908.08/1000 = 0.90808 liters

Now we can use the formula for molarity:

Molarity = moles of solute / liters of solution

Plugging in the given values, we get:

Molarity = 0.55 moles / 0.90808 liters

Molarity = 0.606 M (rounded to three significant figures)

Therefore, the molarity of the student's sugar solution is 0.606 M.

Answer:

The molarity of the student's sugar solution is 0.60 M.

Explanation:

What makes hydrogen and methane hard to condense?

Answers

The essential reason is that a kilogram of hydrogen contains 8 times as many molecules as a kilogram of methane (because the mass of a hydrogen molecule is about 1/8 of the mass of a methane molecule).

Compare the ground-state electron configuration of oxygen and sulfur to that of selenium. What similarities or differences do you observe? How do you think this will affect the relative chemical or physical properties of these elements?


please help i need this as soon as possible thx

Answers

The ground-state electron configurations of oxygen, sulfur, and selenium are 2-8-8, 2-8-6, and 2-8-8-6 respectively. Oxygen and selenium both have 8 electrons in their outermost shell, while sulfur has 6.

This difference affects the chemical and physical properties of these elements, as elements with more electrons in their outermost shells tend to be more reactive due to increased electron availability for bonding.

As oxygen and selenium have the same number of electrons in their outermost shell, they have similar chemical and physical properties. Sulfur, with its fewer outer shell electrons, has different chemical and physical properties than oxygen and selenium.

For more question on selenium click on

https://brainly.com/question/30094538

#SPJ11

In the titration of 25. 00 mL of a water sample, it took 19. 840 mL of 4. 395x10^-3 M EDTA solution to reach the endpoint. Calculate the number of moles of EDTA required to titrate the water sample. (enter your answer with 3 significant figures)

Answers

the number of moles of EDTA required to titrate the water sample is 0.0000872 moles.

We can use the equation for molarity to calculate the number of moles of EDTA required to titrate the water sample:

Molarity = moles of solute / liters of solution

First, we need to calculate the number of liters of EDTA solution used in the titration:

19.840 mL = 19.840 mL x (1 L / 1000 mL) = 0.019840 L

Next, we can use the equation for molarity to solve for the number of moles of EDTA:

Molarity = 4.395x

[tex] {10}^{3} [/tex]

M

Liters of solution = 0.019840 L

moles of solute = Molarity x liters of solution

moles of EDTA = (4.395x

[tex] {10}^{ - 3} [/tex]

M) x (0.019840 L) = 8.720x

[tex] {10}^{ - 5} [/tex]

moles

Therefore, the number of moles of EDTA required to titrate the water sample is 8.720x

[tex] {10}^{ - 5} [/tex]

moles (or 0.0000872 moles) to three significant figures.

learn more about molarity here:

https://brainly.com/question/8732513

#SPJ4

Use the equation for Charles’s Law to calculate the following. (2pts)
A plastic bottle is filled with a gas to the volume of 0.50 L at a temperature of 294.15K. The bottle then placed in a freezer for 24 hours at a temperature of 273.15K.
What is the volume of gas inside the plastic bottle when it is taken out of the freezer?

Answers

Answer:

670,385k

Explanation:

What percent of a sample of As-81 remains un-decayed after 43.2 seconds?

Answers

Answer:

As-81 undergoes radioactive decay with a half-life of 33 seconds. This means that after 33 seconds, half of the original sample would have decayed, and after another 33 seconds, half of the remaining sample would have decayed, and so on.

To find the percent of the sample that remains un-decayed after 43.2 seconds, we can use the following formula:

percent remaining = (1/2)^(t/h) x 100%

where t is the time elapsed and h is the half-life.

Substituting the given values, we get:

percent remaining = (1/2)^(43.2/33) x 100%

percent remaining ≈ 23.2%

Therefore, about 23.2% of the As-81 sample remains un-decayed after 43.2 seconds.

Explanation:

Which of the following atoms would
share properties and number of
electrons in their outermost energy
level?
a. Ne, Ar, and Kr
c. Si, As, and Sb
b. Li, Ca, and Mg
d. P, S, and Cl

Answers

Ne, Ar, and Kr share properties and the number of electrons in their outermost energy level because they belong to the same group (noble gases). Therefore, option A is correct.

What are noble gases and their properties?

Any of a class of rare gases with high stability and very low reaction rates, such as helium, neon, argon, krypton, xenon, and occasionally radon. also known as the inert gas.

Noble gases are low chemically reactive, odorless, colorless, nonflammable, and monotonic gases. Noble gases are exceedingly stable and unlikely to form chemical connections since they have the minimal inclination to receive or lose electrons. Hence, option A is correct.

Learn more about noble gases, here:

https://brainly.com/question/11764545

#SPJ1

A sample of oxygen, O 2 , occupies 32.2 mL at 30 °C and 452 torr. What volume will it occupy at –70 °C and the same pressure?

Answers

The volume that the oxygen gas will occupy at 32.2mL and 30°C is 21.57mL.

How to calculate volume?

The volume of a gas can be calculated using the combined gas law as follows:

P₁V₁/T₁ = P₂V₂/T₂

Where;

P₁, V₁ and T₁ = initial pressure, volume, and temperature respectivelyP₂, V₂ and T₂ = final pressure, volume and temperature respectively

According to this question, a sample of oxygen gas occupies 32.2 mL at 30 °C and 452 torr.

452 × 32.2/303 = 452 × V/203

48.03 = 2.226V

V = 21.57mL

Learn more about volume at: https://brainly.com/question/2441061

#SPJ1

How many type of particles is a pure substance made up of?

Answers

A pure substance is made up of only one type of particle as this is the reason for the denomination 'pure'.

What is the relative chemical composition of a pure substance?

The relative chemical composition of a pure substance is based on only one type of compound or element, which is thus the major determinant of a substance to be considered pure for a given solution.

Therefore, with this data, we can see that the relative chemical composition of a pure substance is based on the presence of one class of element.

Learn more about a pure substance here:

https://brainly.com/question/29775813

#SPJ1

Answer:

A pure substance is made up of only one type of particle. These particles can be atoms, ions, or molecules, depending on the nature of the substance. In other words, a pure substance is homogeneous, meaning that it has the same composition and properties throughout its entire volume.

__Cu + __AgNO3 —-> Cu(NO3)2 + __Ag

what’s the balanced equation?
what the molar ratio for
1) Cu to AgNO2
2) Cu to Ag

Answers

Answer:

1. 1 mole of Cu to 2 moles of AgNO3

2. 1 mole of Cu to 2 moles of Ag

Explanation:

Cu + 2AgNO3 —-> Cu(NO3)2 + 2Ag

Cu = 1

Ag = 2

NO3 = 2

1. 1 mole of Cu to 2 moles of AgNO3

2. 1 mole of Cu to 2 moles of Ag

Separate the Pennie’s you have into two groups: one group with Pennie’s dated before 1982 and the other with pennies dated after 1982. Compare the two groups. Record any similarities or differences in size or appearance that you notice between the two groups

Answers

Using  hypothetical scenario, the Separation of  the Pennie’s are given below

What are the Pennies about?

Pennies dated after 1982 are lighter and thinner because zinc is less dense than copper. However, they have a similar diameter of 19.05mm to pennies dated before 1982. The difference in composition between the two groups is important because copper is a valuable metal, and the cost of producing a penny exceeded its value. By reducing the amount of copper in pennies, the U.S. Mint was able to save money on production costs.

Pennies dated before 1982 are made of 95% copper and 5% zinc and weigh 3.11 grams. They have a diameter of 19.05mm and a thickness of 1.55mm. Pennies dated after 1982 are made of 97.5% zinc and 2.5% copper and weigh 2.5 grams. They have a diameter of 19.05mm and a thickness of 1.52mm.

Therefore, the main difference between the two groups is their composition, weight, and thickness. The pennies dated before 1982 are larger, heavier, and thicker than those dated after 1982.

Learn more about Pennie from

https://brainly.com/question/28840327

#SPJ1

please separate them so I can put it in the right box AND
PLEASE DON'T GET IT FROM WEBSITE MAKE UP YOUR OWN

if it's right Phases of Matter—Comic Strip Template
Instructions: Create a comic strip detailing the adventure of your character as the character is exposed to thermal energy, causing it to undergo phase changes from a solid, to a liquid, to a gas. Place drawings inside the boxes and written content on the lines below each box.

Your presentation must include the following:

title and introduction of your character, including what substance it is made of

source of thermal energy your character encountered (conduction, convection, and/or radiation)

detailed description and/or diagram of the particle transformation from solid to liquid phase

detailed description and/or diagram of the particle transformation from liquid to gas phase



Title of your comic strip: __________________________





________________________

________________________

________________________




________________________

________________________

________________________




________________________

________________________

________________________




________________________

________________________

________________________




________________________

________________________

________________________




________________________

________________________

________________________

will make brainiest :)

Answers

Title of your comic strip: Adventures of Ice Cube.

So, the title will be "Adventure of Ice Cube".

Define the term title.

The term title refers to the name or heading given to a book, article, movie, piece of music, or other creative work that identifies it and distinguishes it from other works. It can also refer to a position or designation given to a person, such as a job title or academic title.

Box 1:

Introduction of character: Meet Ice Cube, a small, square-shaped piece of ice made of water molecules. Ice Cube was comfortably sitting in a glass of water until he was exposed to thermal energy.

Caption: This is Ice Cube. He is made of water molecules.

Box 2:

Source of thermal energy: A warm hand holding the glass of water.

Caption: Suddenly, a warm hand holds the glass of water.

Box 3:

Solid to liquid phase: Ice Cube starts to melt and becomes a liquid as it absorbs thermal energy from the warm hand.

Caption: Ice Cube starts to melt as he absorbs thermal energy from the warm hand.

Box 4:

Liquid to gas phase: Ice Cube continues to absorb thermal energy, and as a result, it transforms into water vapor and evaporates into the air.

Caption: As Ice Cube continues to absorb thermal energy, it transforms into water vapor and evaporates into the air.

Box 5:

Conclusion: Ice Cube's adventure comes to an end, but he realizes that he is never really gone, as his water molecules will always be a part of the water cycle.

Caption: The end. Ice Cube is gone, but his water molecules will always be a part of the water cycle.

Box 6:

Additional Information: Show the water cycle and explain how Ice Cube's water molecules can be a part of it.

Caption: Ice Cube's water molecules will eventually come together with other water molecules to form clouds and rain. Then, they will flow into rivers and oceans, and the cycle starts again.

To learn more about the title click here

https://brainly.com/question/17387714

#SPJ1

Question 23
How would a base isolation system help to protect a building during an earthquake?

A. The base isolation system makes the building move in an opposite direction to
the shaking ground.

B. The base isolation system reduces the strength of an earthquake wave before it
reaches the building.

C. The base isolation system changes the direction of an earthquake wave before it
reaches the building.

D. The base isolation system prevents the building from coming into direct contact
with the shaking ground.

Answers

Answer:

D. The base isolation system prevents the building from coming into direct contact with the shaking ground.

Explanation:

During an earthquake, the ground moves rapidly and can cause significant damage to buildings and infrastructure. A base isolation system is a technique used to protect buildings and other structures from earthquake damage by reducing the amount of shaking they experience. The system involves isolating the building's foundation from the ground using flexible bearings, springs, or pads. This helps to decouple the building from the shaking ground and reduce the amount of energy that is transferred to the structure during an earthquake. By preventing direct contact between the building and the ground, the base isolation system can help to minimize damage to the building and improve its chances of survival during a seismic event.

Answer: D

Explanation: The base isolation system prevents the building from coming into direct contact with the shaking ground. RAHHHHHHHHH

Write the condensed formulas and provide IUPAC name for the following compound:
(a ethyl alcohol (in beverages)

Answers

The condensed formula and IUPAC nomenclature for the chemical ethyl alcohol are [tex]C_{2} H_{6} O[/tex].

The condensed formula approach is what?

Condensed structural formulae, which conserve space and are easier and faster to type out, display the atoms' positions similarly to a structural formula but on a single line. When demonstrating how a group of atoms in a molecule are linked to a single atom, condensed structural formulae are also helpful.

How do you tell whether a formula has been compressed?

The hydrogens (or other ions or groups) that are connected to the carbon atoms are immediately next to one another in condensed chemical formulations. The corners and endpoints of lines are assumed to have carbon atoms in line-angle formulae. As each carbon atom is connected to four hydrogen molecules in total, it is assumed that each one has four bonds.

To know more about condensed formulas visit:

https://brainly.com/question/16700554

#SPJ1

S + 6 HNO3 --> H2SO4 + 6 NO2 + 2 H2O

In the above equation, how many moles of water can be made when 29 moles of HNO3 are consumed?

Answers

Explanation:

Using mole-mole relationship

If 6 moles of HNO3 will give 2 moles of H20

That means,

1 mole of HNO3 will give 1/3 moles of H20

Therefore,

29 mole of HNO3 will give [(1/3) x 29] moles

= 29/3 moles

= 9.67 moles

Please mark brainliest.

Thanks.

How many atoms are in 0.28 moles of Beryllium (Be)?

Answers

Answer:

To determine the number of atoms in 0.28 moles of Beryllium (Be), we need to use Avogadro's number, which is 6.022 x 10^23 atoms per mole.

First, we can calculate the number of moles of Beryllium (Be) in 0.28 moles by multiplying it by Avogadro's number:

0.28 moles x 6.022 x 10^23 atoms/mole = 1.68496 x 10^23 atoms

Therefore, there are approximately 1.68 x 10^23 atoms in 0.28 moles of Beryllium (Be).

Explanation:

The beta decay of potassium 40 produces a beta particle and an atom with an atomic number of

A:18
B:39
C:20
D:21​

Answers

The beta decay of potassium 40 produces a beta particle and an atom with an atomic number of 19.

So option C is correct answer.

What is Atomic Number?

The atomic number is the number of protons found in the nucleus of an atom of a chemical element. It is a fundamental property of an element, which determines its identity and its position in the periodic table.

Each element has a unique atomic number, which is represented by the symbol Z. For example, the element hydrogen has an atomic number of 1, which means that it has one proton in its nucleus. The element carbon has an atomic number of 6, indicating that it has six protons in its nucleus.

potassium that undergoes beta decay. During beta decay, a neutron in the nucleus of the potassium 40 atom is converted into a proton, and a beta particle (which is an electron) is emitted. The resulting atom has one more proton in its nucleus than the original atom, so its atomic number increases by one to 20.

Learn more about Atomic Number from given link

https://brainly.com/question/11353462

#SPJ1

Outline why there is no limit to the number of control variables that an experiment can have.

Answers

Most experimental designs measures solely one or two variables at a time. Any different factor, which could probably impact the results, should be efficaciously controlled.

Why is it vital to restriction the number of variables in an experiment?

Controlling variables is important due to the fact mild variations in the experimental set-up ought to strongly have an effect on the result being measured.

Can an scan have extra than one controlled variable explain?

Controlled variables are portions that a scientist needs to remain constant. If they had been altered, it would appreciably have an effect on the experiment's results. Most experiments have extra than one controlled variable.

Learn more about variables here;

https://brainly.com/question/1388080

#SPJ1

Please help and answer this

Answers

According to the observations, work of scientist uses evidence while work of an engineer uses a practical approach.

What are observations?

Observations are defined as a set of statements or facts which are recorded while conducting an experiment.Observations are made through sensing changes in the variables of the experiment.

It is specifically defined as an act of knowing or recording the changes in the variables of the experiment.Recording observations holds importance as recording observations avoid the experiment to be repeated over and over again.

Learn more about observations,here:

https://brainly.com/question/28041973

#SPJ1

You observe that when oil and water combine, oil always rests on top of the water. What can be said about the density of oil and water?

The density of oil must be greater than the density of water.
The density of oil must be less than the density of water.
The density of oil must be the same as the density of water.

Answers

Answer: As a result, when you add oil to a cup of water the two don't mix with each other. Because oil is less dense than water, it will always float on top of water, creating a surface layer of oil.


A student prepares a solution by dissolving 20.0 g of aluminum chloride (AICI3) in
enough water to produce 500 mL of solution. What is the molarity of the solution?
Polici
0.160 M
0.320 M
0.080 M
0.040 M

A solution must be at a higher temperature than a pure solvent to boil. Which
colligative property can be employed to achieve this?

freezing-point depression
boiling-point elevation
vapor-pressure lowering

Which example will dissolve most slowly?
two sugar cubes
a tablespoon of ultrafine sugar
a tablespoon of table sugar
a tablespoon of coarse sugar

Answers

Answer: b

Explanation:

20.0g AlCl3/133.5715 g Alcl3 = .149732540 moles AlCl3

M=mol/L  = 0.149732540/0.500=0.30

133.4515 (molar mass for AlCl3 from periodic table)

Answer:the second answer is boiling point elevation

the third answer is two sugar cubes

Explanation:

Other Questions
i want to log off of my account how do i do that?? London deposits $100 into a savings account that pays a simplete ineterest rate of 3.4%. Chen deposits $200 into a savings account that pays a simple interest rate of 2.2%. Lodon says that she will earn more interest in one year because her interest rate is higher than Pablo's. Rachel and David were shopping for holiday gifts when they noticed a Thanksgiving sweater on the discount rack. Rachel really wanted the sweater, even though she wouldnt be wearing it until Thanksgiving of 2021! .Rachel has a coupon for an additional 25% off the sale price of the sweater. If she pays for the shirt with a $10 bill, what will her change be? A spinner has 3 equal sections colored blue, orange, and red. Determine the sample space for spinning the spinner two times.Spin 1 Spin 2Blue OrangeBlue RedBlue BlueBlue RedRed OrangeRed RedOrange BlueOrange RedOrange OrangeOrange BlueSpin 1 Spin 2Blue OrangeBlue RedBlue BlueRed BlueRed OrangeOrange BlueOrange RedOrange OrangeSpin 1 Spin 2Blue OrangeBlue RedBlue BlueRed BlueRed OrangeRed RedOrange BlueOrange RedOrange OrangeSpin 1 Spin 2Blue OrangeBlue RedRed BlueRed OrangeOrange BlueOrange Red How are plate boundaries related to the Earths plates? A. Boundaries can be anywhere in an ocean basin or a continent. B. Boundaries are always where ocean basins meet continents. C. Boundaries are always in the middle of ocean basins. D. Boundaries are not found in continents. What is the problems of photosynthesis? Eight triangles are drawn within a square to create the shaded region in the figure. InstructionsRead the question carefully and select the best answer.Based on the following passage, which of the following best explains why factions might develop?The latent causes of faction are thus sown in the nature of man; and we see them everywhere brought into different degrees of activity,according to the different circumstances of civil society. A zeal for different opinions concerning religion, concerning government, and many otherpoints, as well of speculation as of practice; an attachment to different leaders ambitiously contending for pre-eminence and power; or to personsof other descriptions whose fortunes have been interesting to the human passions, have, in turn, divided mankind into parties, inflamed them withmutual animosity, and rendered them much more disposed to vex and oppress each other than to co-operate for their common good.DA It is natural for individuals to have different opinions. How could the North's factories be considered an advantage? (I point)O The factories could sell surplus goods to Europe for money.O The factories could be converted to making supplies for the army.OThe factories could get cotton from the West instead.OThe factories could use newly freed African Americans as a cheap source of labor. In the 2020 NFL season, Drew Brees completed 73.5% of his attempted passes, and Patrick Mahomes completed 68.8% of his attempted passes. Based on those statistics, which of the following statements is true? A. Drew Brees must have attempted more passes B.Patrick Mahomes must have completed more passes C.Either quarterback could have completed more passes D.. Drew Brees must have completed more passes Faisal deposits a single sum of money into an investment opportunity that pays 1% compounded annually. How much must he deposit in order to withdraw $3,024/year for 5 years, with the first withdrawal occurring 2 year after deposit? Qustion#3 [4+6](a) Impact of culture is pervasive.- Explain the statement.(b) What are some particularly troublesome problems caused bylanguage in foreign marketing? Discuss. Find the constant of variation k for the direct variation.f(x)0-1-2-3.5x02047 Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG