2. Heather had six 2-liter bottles of soda. She poured the soda into containers which each have a capacity of 1 gallon.


Part A: How many total liters of soda did Heather have? _______________________






Part B: How many gallon containers did she fill before she ran out of soda? _______________________

Answers

Answer 1
Part A: 12liters

Part B: She filled 2.63963 containers = 3
Answer 2

Part A: Heather had a total of 12 liters of soda.

Part B: She filled 3 gallon containers before running out.

Part A: To find the total liters of soda Heather had, we need to convert the 2-liter bottles into liters and then sum them up.

Each 2-liter bottle is equal to 2 liters.

Since Heather had six 2-liter bottles, the total amount of soda in liters is:

6 bottles * 2 liters/bottle = 12 liters

So Heather had a total of 12 liters of soda.

Part B: To determine how many gallon containers she filled before running out of soda, we need to convert the liters of soda into gallons and then divide by the capacity of each container.

Since 1 gallon is equal to approximately 3.785 liters, we can divide the total liters by the conversion factor:

12 liters / 3.785 liters/gallon ≈ 3.17 gallons

Heather filled approximately 3.17 gallon containers before running out of soda. However, since we can't have a fraction of a container, we can assume she filled 3 gallon containers before running out.

To know more about liters  click here :

https://brainly.com/question/30848296

#SPJ2


Related Questions

HELP ME ASAP

no links no files and no websites

Answers

Answer:

I got you!

Step-by-step explanation:

If you calculate the area you must multiply both sides.

The answer may be the following:

Exact Form: 203/18

Decimal form: 11.27...

Mixed number form: 11 5/8

btw take care of yourself and love ur profile picture!

                                               -lei

The answer is 11/58 :))))

Joe must choose a number between 49 and 95 that is a multiple of 3 , 9, and 12 . Write all the numbers that he could choose. If there is more than one number, separate them with commas.

Answers

The first number 49 or larger that is divisible by 3 is 51 (17 * 3 = 51) so begin at 51 and count by 3's until you get to 95:51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93The first number 49 or larger that is divisible by 6 is 54 (6 * 9 - 54) so begin at 54 and count by 6's until you get to 95:54, 60, 66, 72, 78, 84, 90The first number 49 or larger that is divisible by 9 is 54 (9 * 6 - 54) so begin at 54 and count by 9's until you get to 95:54, 63, 72, 81, 90Now look for the numbers that are in all three lists

The only number that is a multiple of 3, 9, and 12 between 49 and 95 is 72

math=heaven or math=hell
(or you can solve this for 5 points)

Answers

Answer:

51 [tex]\frac{1}{35}[/tex]ft²

Step-by-step explanation:

6 5/7 = 47/7

7 3/5 = 38/5

----------------------

a = 47/7 * 38/5

a = 1786/35

Reduce

a = 51 [tex]\frac{1}{35}[/tex] ft²

maaaath. isssss. heeeeellllll.

PLEASE HELP ME!!!!!!!! THIS IS TIMED PLEASE HELP ME!!!!!!!!!! PLEASE HELP!!!!!!!!!

Answers

I think if you do 11 - 6 = 5 because it say that 6 not play so you would do 8 - 2 = 6 and then you do 6 + 5 = 11 because the says in all
11-6=5
8-2=6
Answer 6+5=11

janet bought a dress for $245. she recived a 15% discount vecause she is a loyal customer. in addition she recived another 10% off. calculate janets final bill​

Answers

$187.42 !!!!!!!!!!!!!!!!!!!!
First turn 15% into a decimal= .15
Multiply .15 * 245 =$36.75 ok that’s the first discount!

Second discount is 10% so turn 10% into a decimal (by dividing your percentage by 100) = .10
Multiply .10*245= $24.50 <- that’s your second discount

Ok now take both those answers and subtract them from her original $245 bill.

245-(24.50+36.75)= $183.75

Her final bill is $183.75

Marna thinks that about 35% of her mail is junk mail. She gets about twice as much regular mail as junk mail. Is she correct? Explain.

Answers

Answer: no

Step-by-step explanation:
70 percent and 35 is more than enough
The answer is not correct
Explanation:

Solve each of the following equations. Show its solution set on a number line. Check your answers.
|6m-2|=0
1-|3p+1|= -3
|3x-2|=19
|3(x-2)|=12

NUMBER LINE FORMAT.
BRAINLIEST
40 POINTS

Answers

1) | 6m - 2 | = 0
6m = 2
m = 1/3

2) 1 - | 3p + 1 | = -3
- | 3p + 1 | = -4
-3p - 1 = -4
-3p = -3 or 3p = -5
p = 1, -5/3

3) | 3x - 2 | = 19
3x = 21 or -3x + 2 = 19
-3x = 17
x = 7, -17/3

4) | 3(x - 2) | = 12
3x - 6 = 12 or -3x + 6 = 12
3x = 18 or -3x = 6
x = 6, -2

The value of m is 1/3 of equation  |6m-2|=0,  |3(x-2)|=12 of p are 1, -5/3 for equation 1-|3p+1|= -3,  value of x are 7, -17/3 for equation |3x-2|=19 and

value of x are 6, -2 for |3(x-2)|=12

The first equation is |6m-2|=0

| 6m - 2 | = 0

6m = 2

Divide both sides by 6

m = 1/3

The value of m is 1/3.

The second equation is 1 - | 3p + 1 | = -3

- | 3p + 1 | = -4

-3p - 1 = -4

Add 1 on both sides

-3p = -3 or 3p = -5

The value of p are 1, -5/3

3) Third equation is | 3x - 2 | = 19

3x = 21 or -3x + 2 = 19

-3x = 17

Divide both sides by 3

The value of x are 7, -17/3

4) | 3(x - 2) | = 12

3x - 6 = 12 or -3x + 6 = 12

3x = 18 or -3x = 6

The value of x are 6, -2

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ2

2 1\4 - 3\4




it for my little sister

Answers

Answer:

1 2/4 or 1 2/4

Step-by-step explanation:

convert 2 1/4 into an improper fraction.

9/4-3/4=6/4

make 6/4 into a mixed number.

1 2/4

simplify

1 1/2

Math probability
Please help

Answers

The answer is 12/30.
We have 12 red marbles and 30 marbles in total, so the probability is red marbles/total marbles=probability of getting a red marble!

A factory makes aquariums. Each aquarium is in the shape of a triangular prism, as shown below. If the factory made aquariums that require a total of
of water, how many aquariums did the factory make?
12,600 ft of water, how many aquariums did the factory make?

Answers

Answer:

the answer is 384

Step-by-step explanation:

The factory made about 382 aquariums:

Find the area of figure 3.

Answers

The answer is 4 square meters

Evaluate the problem

3.14(6 × 4 + 6^2)

Answers

Answer:

188.4

Step-by-step explanation:

the answer is 188.4.

what type of association is shown in the scatterplot

Answers

Answer:

Positive linear association

Step-by-step explanation:

As the time increases so does the points.

Can y’all help with this I don’t understand it

Answers

The answer is $990. Because 0.36 times 2750=990

Answer:

The answer is $990. Because 0.36 times 2750=990

Step-by-step explanation:

can i have brainliest?

Only answer if you know the correct answer! Thanks! :)

Answers

Answer:

1. 1/36

2. 1

3. 0.001

4. 8

Step-by-step explanation:

Answer:

1. 1/36

2. 1

3. 0.001

4. 8

Step-by-step explanation:

anything to the zero power is equal to one :)

I hope these helped

On your own paper, plot the Points E(−2,2) and F(8,10). Use the vertical and horizontal grid lines to draw a right triangle with these two points as vertices.

Question 1
Part A

Label the third vertex of your right triangle Point G. Identify the two possible coordinates of Point G.

Enter the correct answers in the boxes

Answers

Answer:

(-2, 10) and (8, 2)

Step-by-step explanation:

The point of a square pyramid is cut off, making each lateral face of the pyramid a trapezoid with the dimensions shown.

A trapezoid has a base of 3 inches, height of 1 inches, and top side length of 1 inch.

What is the area of one trapezoidal face of the figure?

Answers

The trapezoid face of a figure will also be known as the trapezoid area.

Trapezoid area formula:

(base1 + base2)/2 * height

Let’s plug in some values

(3 + 1)/2 * 1
(4)/2 * 1
2 * 1
2

The area of the trapezoidal face would be 2 in^2

Can anyone help with this?

Answers

Answer: I would say B is correct

Step-by-step explanation:

You should choose b as the answet

answer why? bc yes :>

Answers

Answer:

Your answer is 40.7 or 40 and 7/10

Step-by-step explanation:

A = L*w

A= 7.5*5.5

A= 40.7 or 40 and 7/10

n order to bring back customers to the AMC Movie Theaters, they are offering two movie plans; a Family Plan of 4 used to cost $25 is now discounted to $19.05; and the Individual Plan used to cost $12.50 is now discounted to $10. Which of the two AMC Movies plans is the better plan? pls help me asap!

Answers

Is gonna be the family plan please give brainlist and help me report the comment on top is a page virus

Answer:

family plan

Step-by-step explanation:

family plan: $19.05/4 = 4.76 per person and individual plan: $10 per person

What is the volume of water in the trough in cubic feet when the trough is full?

Answers

If I’m correct the answer should be C. 70ft 3

Which quadrilaterals must have both pairs of opposite angles that are congruent?
parallelogram and rhombus
rhombus and trapezoid
trapezoid and parallelogram
trapezoid and kite

Answers

the correct answer is c

Answer:

i believe the answer is C

Step-by-step explanation:

Seth's bank charges $7 a month to maintain a checking account and $0.50 for each check Seth writes. Last month, Seth paid a total of $11.50 in checking account fees. How many checks did he write?
A. 6
B. 7
C. 8
D. 9

Answers

11.50-7=4.5; 4.5/0.5=9
He wrote 9 checks.
Seth wrote 9 checks that month

The equation shows the relationship between x and y:

y = 6x + 1

What is the slope of the equation?

1
5
6
7

Answers

6
y= the t intercept which is 1
what the other person said

Which point on the grid have they not explored?

A. (0,3)

B. (-2,-2)

C. (3,-3)

D. (-3,1)

Answers

Answer:

(-3, 1)

Step-by-step explanation:

The answer is D (-3,1)

Please answer soon!!!!!!!!!!!

Answers

Answer:

The second choice

The two events are dependent, so the probability of the second event is 1/3. P = 1/12

Step-by-step explanation:

The second choice... 1/12

What is the area of the object (PROVIDE NUMBER ONLY) *

Answers

area - 90 ft :) hope this helps

Answer:

45

Step-by-step explanation:

You use the equation A=1/2BH

plug in 6 and 15 and multiply

Victor wants to conduct a survey to find how much time the students of his school spent playing football. Which of the following is an appropriate statistical question for this survey?

Who plays football on weekends?
Who plays football the most on Mondays?
How many hours per week do you play football?
How many students play football for one hour every day?

-----------------------------
honestly the best route on brainly is being a troll since nobody does anything about it..

Answers

Answer:

C,How many hours per week do you play football?

Step-by-step explanation:

bcz i knw

C. How many hours per week do you play football?
It’s the only good question, since it asks how much hours they play football, not what days do you play football etc.

Help me with this plzzz

Answers

The answer is c 16475
the right answer is c 16475

Only answer if you know the correct answer! Thanks! :)

Answers

Answer:

i=35

Step-by-step explanation:

105÷3=35

3×35=105

Answer:

i = 35

Step-by-step explanation:

You just do the opposite. In this equation you multiply but you could do the inverse operation which is division. 105 divided by 3 equals 35. You can also check, 35x3 which equals 105. (sorry if this is confusing)

Other Questions
i need help im almost done and this is my second to last question probably helpppp please help !!!!!!!! conjugate these three words in the future tense: I will be awarding brainliest for anybody who gets it right, 3 new titles for Insurgent and a paragraph describing why The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number