13. According to the international guidelines, dairy products could have a total coliform count (total count on Macconkey) up to
10 4
CFU/g
, and they will still be considered acceptable for consumption, above this number they will be unacceptable. A milk brand was doubted to be the cause of food poisoning, a sample of the milk was tested in the lab. Results are summarized in table below. Table. Number of colonies obtained in different serial dilutions of a milk sample ivure: piated amount on each plate is
0.1ml
. Is this milk sample good for consumption? Explain why? Show your calculation and explain your dilution factor choice.

Answers

Answer 1

The milk sample has a total coliform count of 7.2 x 10^8 CFU/g, which is much higher than the acceptable limit of 10^4 CFU/g. Therefore, the milk sample is not safe to consume.

Based on the provided data in the question, it can be concluded whether the milk sample is good for consumption or not. The total coliform count limit for dairy products is 10^4 CFU/g. If the total coliform count is above this limit, the dairy product is considered unacceptable for consumption.The number of colonies obtained from different dilutions of the milk sample is provided in the table below:

Table: Colonies obtained from different dilutions of the milk sampleDilution 1: 270 CFU/mlDilution 2: 1200 CFU/mlDilution 3: 10,800 CFU/mlDilution 4: 72,000 CFU/ml. The dilution factor is the amount of the original milk sample that is diluted with sterile water. It is denoted as DF. To determine the total coliform count of the original milk sample, the number of colonies obtained from the highest dilution is multiplied by the dilution factor (DF).For instance, the total coliform count for dilution 4 would be:

Total coliform count for dilution 4 = Number of colonies x DFTotal coliform count for dilution 4 = 72,000 x 10^4

Total coliform count for dilution 4 = 7.2 x 10^8 CFU/g

Since the total coliform count of the milk sample is higher than the acceptable limit, the milk sample is not suitable for consumption.

More on dairy products: https://brainly.com/question/30382641

#SPJ11


Related Questions

Will a weakly basic drug (methamphetamine) with apKa of 10.0 accumulate more in the urine (assuminga pH = 6.0) or in the blood space (assuming a pH= 7.4) ?

Answers

The weakly basic drug (methamphetamine) with apKa of 10.0 accumulate more in the urine than in blood.

A weakly basic drug (methamphetamine) with a pKa of 10.0 will accumulate more in the urine (assuming a pH = 6.0) than in the blood space (assuming a pH = 7.4). This is because the drug will be more ionized in the urine than in the blood space. Ionized drugs are more likely to accumulate in a specific compartment because they are less likely to diffuse across membranes. Therefore, the weakly basic drug will accumulate more in the urine than in the blood space.

The main organ in charge of removing medicines and their metabolites is the kidney. Early prenatal development is when renal function starts to develop, and early childhood is when it is finished.

where the overall clearance of medicines may be influenced by the glomerular filtration rate (GFR), active tubular secretion (ATS), and active tubular reabsorption (ATR). Only free (unbound) drugs and their metabolites can pass through a healthy glomerulus and be released or reabsorbed by a renal tubular transport protein during hepatic drug metabolism.

For more such questions on drug , Visit:

https://brainly.com/question/30796747

#SPJ11

When serologists typed blood, they usually performed a species
test first. With DNA typing, this is no longer necessary. Why?

Answers

The species test is no longer necessary in DNA typing because DNA contains species-specific sequences that can be used to determine the species of origin.

DNA contains specific sequences that are unique to each species. By analyzing these sequences, it is possible to determine the species of origin of a DNA sample without the need for a separate species test.

In contrast, serological tests rely on the presence of antigens that are specific to certain blood types, which can vary between individuals of the same species.

Therefore, a separate species test was required before blood typing could be performed using serological methods and a species test is no longer necessary in DNA typing.

To know more about species-specific sequences click here:

https://brainly.com/question/13022875

#SPJ11

What do you think will happen if the following scenario happened while estimating for the carbon dioxide evolved in soil?
A. Glass jars were not sealed and left opened during incubation
B. Barium chloride was not added to the solution prior to titration
C. Soil samples were incubated without KOH solution
D. Peptone was added in all soil jar set-ups
E. Phenolphthalein indicator was not added prior titration

Answers

If the following scenario happened while estimating for the carbon dioxide evolved in soil, the results would likely be inaccurate and unreliable.

A. Glass jars were not sealed and left opened during incubation: This would allow for external gases to enter the jars, which would alter the amount of carbon dioxide present and lead to inaccurate results.


B. Barium chloride was not added to the solution prior to titration: Barium chloride is used to precipitate the carbon dioxide as barium carbonate, allowing for it to be measured accurately. Without it, the carbon dioxide would not be able to be accurately measured.


C. Soil samples were incubated without KOH solution: KOH solution is used to absorb the carbon dioxide produced by the soil samples. Without it, the carbon dioxide would not be accurately measured.


D. Peptone was added in all soil jar set-ups: Peptone is a source of carbon and nitrogen that can stimulate microbial activity and increase the amount of carbon dioxide produced. If it is added to all soil jar set-ups, it would alter the amount of carbon dioxide produced and lead to inaccurate results.


E. Phenolphthalein indicator was not added prior titration: Phenolphthalein indicator is used to indicate the endpoint of the titration, allowing for the accurate measurement of the amount of carbon dioxide present. Without it, the titration would not be accurate.

Learn more about carbon dioxide at

https://brainly.com/question/25385913

#SPJ11

A cell that contains a nonfunctional DNA polymerase can be considered a a. Wild-type cell b. Mutant cell c. Recessive dominant cell d. Heterozygous cell

Answers

A cell that contains a nonfunctional DNA polymerase can be considered a B. mutant cell.

DNA polymerase is an enzyme that is crucial for DNA replication, and if it is nonfunctional, it can lead to mutations in the DNA. This enzyme catalyzes the polymerization of nucleotides into DNA strands.

Therefore, a cell with a nonfunctional DNA polymerase would be considered a mutant cell, as it contains a mutation that affects the function of the DNA polymerase enzyme. Mutations in DNA can be passed from parents to offspring. The other options, wild-type cell, recessive dominant cell, and heterozygous cell, do not accurately describe a cell with a nonfunctional DNA polymerase.

Learn more about DNA polymerase at:

https://brainly.com/question/14315652

#SPJ11

______ It is complication present in preterm where a hole (perforation) may form in your baby'sintestine. Bacteria can leak into the abdomen (belly) or bloodstream through the hole.

Answers

The complication that you are referring to is called Necrotizing Enterocolitis (NEC). This condition is commonly present in preterm babies and can be very dangerous.

NEC occurs when the tissue in the small or large intestine is injured or begins to die off. This can cause a hole (perforation) to form in the intestine, which allows bacteria to leak into the abdomen or bloodstream. This can lead to serious infections and can be life-threatening for the baby.

The exact cause of NEC is not known, but it is believed to be related to the immaturity of the baby's digestive system. Other factors that may contribute to the development of NEC include poor blood flow to the intestines, an infection, or the use of certain medications.

Treatment for NEC typically involves stopping feedings, providing intravenous (IV) fluids and nutrition, and giving antibiotics to treat any infections. In severe cases, surgery may be needed to remove damaged sections of the intestine.

It is important to closely monitor preterm babies for signs of Necrotizing Enterocolitis (NEC), as early detection and treatment can greatly improve the outcome. Signs of NEC may include abdominal swelling, vomiting, bloody stools, and lethargy. If you notice any of these symptoms in your baby, it is important to seek medical attention immediately.

Here you can learn more about Necrotizing Enterocolitis (NEC)

https://brainly.com/question/29387310#

#SPJ11

7.2 cell structure visual analogy

Answers

In a cell, the various organelles can be compared to the different parts of a factory. the different organelles of a cell can be thought of as analogous cell's survival and function.

How can the organelles of a cell be compared to different parts of a factory, and what is the role of these organelles in carrying out the necessary processes for the cell's survival and function ?

For example, the nucleus can be thought of as the factory manager's office, where the instructions for making the product are stored. The endoplasmic reticulum (ER) can be compared to an assembly line, where proteins and lipids are synthesized and modified.

The Golgi apparatus is like a packaging and shipping department, where molecules are sorted, packaged, and shipped to their final destinations. The mitochondria can be compared to a power plant, where energy is generated for the cell.

In this way, the different organelles of a cell can be thought of as analogous to the different parts of a factory, working together to carry out the complex processes necessary for the cell's survival and function.

In a cell, the various organelles can be compared to the different parts of a factory. Just as a factory has different machines and departments that work together to produce a product, a cell has different organelles that work together to carry out various functions.

To learn more about analogous follow the given link: https://brainly.com/question/11154123

#SPJ1

For the purposes of our lab today, we will consider a substance to be mutagenic if the number of bacterial colonies on that substance's plate is greater than ____ the number of colonies on the negative control plate.

Answers

For the purposes of our lab today, we will consider a substance to be mutagenic if the number of bacterial colonies on that substance's plate is greater than twice the number of colonies on the negative control plate.

The Ames test is a technique used in molecular biology to identify mutagenic chemicals or carcinogens. It was named after Bruce Ames, the American biochemist who devised it in the 1970s. The test is used to detect the potential of a chemical to cause genetic mutations that could lead to cancer by comparing the number of bacterial colonies on a plate that has been exposed to a substance with that of a control plate.

In the lab, a substance is considered to be mutagenic if the number of bacterial colonies on that substance's plate is greater than two times the number of colonies on the negative control plate. This implies that the substance under examination has a higher mutation rate than the negative control plate. In this way, the Ames test can detect whether or not a chemical has mutagenic properties, and is frequently used in the food and cosmetics industries to evaluate the safety of goods.

You can learn more about genetic mutations at: brainly.com/question/1282397

#SPJ11

Which sample took the least time to become white? Why was that the case? (5 points) In this scenario, the milk sample that was held at ambient temperature for 4 hours after being removed from the refrigerator took the shortest time to turn white. As a result, bacterial growth in this milk is greater than in another milk sample, which reduces methylene blue and changes the milk's color from blue to white.

Answers

In this scenario, the sample that took the least time to become white was the milk sample that was held at ambient temperature for 4 hours after being removed from the refrigerator. This was the case because the warmer temperature allowed for greater bacterial growth in the milk, which reduced the methylene blue and changed the milk's color from blue to white.

The other milk sample, which was kept at a lower temperature, had less bacterial growth and therefore took longer to turn white.  Based on the information provided, the milk sample that was held at ambient temperature for 4 hours after being removed from the refrigerator took the least time to turn white. This is likely because the longer the milk is kept at ambient temperature, the more time bacteria have to grow and proliferate.

Bacteria thrive in warm, moist environments, and milk left at room temperature provides an ideal environment for bacterial growth. As bacteria grow, they consume the nutrients in the milk and produce waste products that can cause the milk to spoil and change color.

Read more about  scenario  here:https://brainly.com/question/25020828

#SPJ11

What should you do after applying the tourniquet if the vein feels hard or rope like?

Answers

After applying the tourniquet, if the vein feels hard or rope-like, you should remove the tourniquet and find a different vein.

A hard or rope-like vein may be a sign of a damaged or blocked vein, and attempting to draw blood from it could cause further damage or be unsuccessful. It is important to find a healthy vein to ensure a safe and successful blood draw. If you are unable to find a suitable vein, it is recommended to seek assistance from a healthcare professional.

To know more about tourniquet refer here:

https://brainly.com/question/28431218

#SPJ11

Select the most correct answers for the advantages of using a micropipettor to deliver small volumes of solution a) accurate and precise results no matter the technique. b) accurate and accurate results depending on the technique. c) adjustable volumes from the same pipette, no matter the technique. d) adjustable volumes within the range of the pipette, depending on technique.

Answers

Answers

The most correct answers for the advantages of using a micropipettor to deliver small volumes of solution are: a) accurate and precise results no matter the technique and c) adjustable volumes from the same pipette, no matter the technique.

Explanation

A micropipettor is a laboratory tool that is used to measure and dispense small volumes of liquid. One of the main advantages of using a micropipettor is that it provides accurate and precise results no matter the technique. This is because micropipettors are designed to deliver a specific volume of liquid with a high degree of accuracy and precision.Another advantage of using a micropipettor is that it allows for adjustable volumes from the same pipette, no matter the technique. This means that you can use the same micropipettor to dispense different volumes of liquid without having to switch to a different pipette. Therefore, the correct answers are a) accurate and precise results no matter the technique and c) adjustable volumes from the same pipette, no matter the technique.

To learn more about micropipettor  visit:https://brainly.com/question/16012111

#SPJ11

What is the energy yield number of ATP produced in aerobic metabolism of glucose What is the energy yield from anaerobic glycolysis?

Answers

The energy yield number of ATP produced in aerobic metabolism of glucose and the energy yield from anaerobic glycolysis is 36 ATP molecules, and 2 ATP molecules, respectively.

Aerobic metabolism is a process that occurs when there is adequate oxygen present in cells. The breakdown of glucose in the presence of oxygen produces a net total of 36-38 ATPs (Adenosine triphosphate), depending on which source of literature is used. Glycolysis yields 2 ATP molecules in the first step of glucose metabolism. The electron transport chain has a total yield of 34 ATP molecules. The 34 ATP molecules are produced by the electron transport chain in the last step of aerobic respiration. In the end, the yield is a net total of 36 ATP molecules (2 from glycolysis and 34 from the electron transport chain)

Anaerobic respiration is a type of respiration that occurs when there is an absence of oxygen in cells. In the absence of oxygen, the breakdown of glucose produces only 2 ATP molecules. The yield is a net total of 2 ATP molecules (from glycolysis) and 2 lactate molecules as end products. Anaerobic respiration produces less energy (only 2 ATP molecules) than aerobic respiration (36 ATP molecules). Therefore, anaerobic respiration is less efficient.

Learn more about ATP here: https://brainly.com/question/893601.

#SPJ11

A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?
Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math.

Answers

The expected ratio of purple to white-flowered plants in the F2 generation is 1:1.

What is the chi-squared test?

The chi-squared test is a statistical test used to compare an expected distribution of values to an actual distribution of values. It's frequently used to determine whether a sample data set is representative of a larger population data set. The observed frequencies, expected frequencies, and degrees of freedom are all necessary to complete a chi-squared test.

Using the chi-squared test, the formula is

Χ² = (observed - expected)²/expected

The expected total for both colors is 40, and the observed is 53 pink and 27 white. Therefore,

Χ² = [(53 - 40)²/40] + [(27 - 40)²/40], which is equal to 0.3125.

Given that the value of the chi-squared test is lower than 3.84 (which is the critical value for 1 degree of freedom at a 5% significance level), the hypothesis that the phenotypic difference is due to two alleles in one gene is accepted.

For more information about chi-squared test refers to the link: https://brainly.com/question/14082240

#SPJ11

Many fossils are buried inside the canyon wall. What do you think scientists can infer from the rock layer in which a fossil is found? Construct an explanation to support your answer.

Answers

By analyzing the rock layer in which a fossil is found, scientists can gain valuable information about the age, habitat, and ecology of the organism, as well as the geology and climate of the region during the time period in which it lived.

What is Fossil Fuels?

Fossil fuels are natural resources that are formed from the remains of dead organisms, such as plants and animals, that have been buried for millions of years and have undergone geological processes such as heat and pressure. The three main types of fossil fuels are coal, oil, and natural gas, and they are used to generate energy to power many aspects of modern society, including transportation, heating and cooling homes and businesses, and electricity generation.

Scientists can infer a variety of information from the rock layer in which a fossil is found. For example, they can determine the age of the fossil by analyzing the age of the rock layer in which it is located. This is because different layers of rock form at different times, and by examining the properties of the rock, scientists can determine its age.

Additionally, scientists can use the characteristics of the rock layer to make inferences about the environment in which the organism lived. For example, sedimentary rocks that contain fossils may provide information about the type of habitat that the organism lived in, such as a riverbed, lakebed, or ocean floor.

Learn more about Fossil Fuels from given link

https://brainly.com/question/79954

#SPJ1

According to "Neural correlates of accelerated auditory processing in children engaged in music training by Habibi et al 2016", What were the control groups used and why did they choose those control groups? What does this study suggest about the impact of musical training on the brain?

Answers

According to the study "Neural correlates of accelerated auditory processing in children engaged in music training" by Habibi et al 2016, the control groups used were children who were not engaged in any musical training and children who were engaged in sports training.

About musical training effects

The reason why these control groups were chosen is because the researchers wanted to compare the effects of musical training on the brain to those of other activities that do not involve music, such as sports.

The study suggests that musical training has a positive impact on the brain, as it was found that children who were engaged in musical training had accelerated auditory processing compared to the control groups.

This suggests that musical training can enhance the brain's ability to process auditory information, which can have a positive impact on various cognitive functions, such as attention, memory, and language.

Learn more about music training at

https://brainly.com/question/14394449

#SPJ11

The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of

Answers

The windpipe is properly called the trachea. At its lower end it divides into right and left bronchi, which then branch into progressively smaller bronchioles. The bronchioles eventually lead to the alveolar ducts of the lungs, which terminate in structures called alveoli.

The walls of the alveoli are composed of thin, permeable membranes that allow for the exchange of gases between the lungs and the blood. These structures are all important parts of the respiratory system, which is responsible for bringing oxygen into the body and removing carbon dioxide.

The trachea, sometimes referred to as the windpipe, is the main airway in the human body and is located in the neck. At its lower end, the trachea divides into two main bronchi, the right and left bronchi, which then branch into progressively smaller bronchioles.

These bronchioles eventually lead to the alveolar ducts of the lungs, which terminate in tiny sac-like structures called alveoli. The alveoli are surrounded by thin, permeable membranes that allow for the exchange of gases between the lungs and the blood. This exchange of oxygen and carbon dioxide is essential for the functioning of the body and is enabled by the respiratory system.

Learn more about bronchioles at: https://brainly.com/question/27010145

#SPJ11

A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26μm. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend?

Answers

Based on the information provided, the medical technologist’s diagnosis is Giardiasis, a protozoan infection caused by Giardia lamblia. This diagnosis is based on the size of the organisms observed (ranging from 12-26μm) and their location within the Zn-PVA fecal sample.

Other criteria that could be used to support this diagnosis include the presence of a cyst or motile trophozoite form of the organism, or the observation of a Giardia-like structure within the fecal sample. To confirm the diagnosis of Giardiasis, further testing such as an antigen detection test or enzyme immunoassay (EIA) could be recommended.

The antigen detection test, also known as a Giardia antigen ELISA (GALE), detects the presence of antigens from Giardia lamblia in the stool sample. The EIA test uses antibodies to detect the Giardia antigen in the sample. If the diagnosis is confirmed, appropriate treatments could be prescribed.

In conclusion, the diagnosis of Giardiasis can be supported by the size of the organisms observed in the Zn-PVA fecal sample, as well as the presence of a cyst or motile trophozoite form. To confirm the diagnosis, an antigen detection test or EIA could be recommended. Appropriate treatments can then be prescribed if the diagnosis is confirmed.

To know more about infection refer here:

https://brainly.com/question/28964805#

#SPJ11

If there is no supply of ATP that means solute transport? a).Will only be able to occur passively through channels and carrier b) Will only be able to occur actively through pumps c) Will only be able to occur passively through antiporters d) Will only be able to occur actively through channels and carriers

Answers

If there is no supply of ATP, solute transport will only be able to occur passively through channels and carriers.

Thus, the answer is option A.

ATP stands for Adenosine triphosphate, which is an energy-rich molecule. It provides energy to perform all metabolic activities. The transport of solutes is an energy-requiring process. The process is done with the help of different carrier proteins, pumps, channels, and antiporters.

When the supply of ATP is not sufficient or there is no supply of ATP, then the transport of solutes occurs passively. It occurs through channels and carriers. In passive transport, the solutes move from the region of higher concentration to the region of lower concentration. It occurs along the concentration gradient.

For more information about ATP refers to the link: https://brainly.com/question/174043

#SPJ11

There are thousands of different reactions that occur in the human body. There are many control systems that regulate enzyme reactivity. Enzyme inhibition decreases the ability of an enzyme to catalyze a reaction. There are several forms of enzyme inhibition . Choose the type of inhibition involved in this example: Aspirin forms a covalent bond to cyclooxygenase enzyme halting production of prostaglandins as shown below A ) irreversible inhibition B ) denaturation of the protein structur C ) allosteric inhibition

Answers

The question asks us to identify the type of enzyme inhibition involved in the example given. The example is that aspirin forms a covalent bond to cyclooxygenase enzyme, halting production of prostaglandins. This type of enzyme inhibition is known as irreversible inhibition.

Reversible inhibition occurs when an enzyme is reversibly bound by an inhibitor molecule, meaning that the enzyme-inhibitor complex can be broken down and the enzyme is able to continue with its normal activity. Irreversible inhibition, on the other hand, occurs when an inhibitor binds to the enzyme and is not easily released. In this case, the inhibitor molecule becomes covalently bound to the enzyme, permanently inactivating it.

In the example provided, aspirin forms a covalent bond to the cyclooxygenase enzyme, halting its production of prostaglandins. This type of enzyme inhibition is known as irreversible inhibition. It is different from denaturation of protein structure and allosteric inhibition, which are both reversible enzyme inhibitions.

Know more about enzyme inhibition here:

https://brainly.com/question/29562365

#SPJ11

What is part of nervous system that carries messages between brain/spinal cord and the rest of the body ?

Answers

The part of the nervous system that carries messages between the brain/spinal cord and the rest of the body is called the peripheral nervous system (PNS).

The PNS is made up of nerves and ganglia outside of the brain and spinal cord. It is responsible for connecting the central nervous system (CNS), which includes the brain and spinal cord, to the limbs and organs. The PNS is further divided into two main systems: the somatic nervous system, which controls voluntary movements, and the autonomic nervous system, which controls involuntary functions such as breathing and digestion. The PNS is essential for communication between the CNS and the rest of the body, allowing us to move, feel sensations, and respond to our environment.

For more such questions on PNS, click on:

https://brainly.com/question/14312818

#SPJ11

If cell membranes WEREN’T selectively permeable to compounds like sugars and amino acids, what would happen to the nutrients that the cell brings in

Answers

If cell membranes weren't selectively permeable to compounds like sugars and amino acids, the nutrients that the cell brings in would not be regulated properly. This means that there would be an imbalance of nutrients inside and outside of the cell, which could lead to a number of problems.

First, the cell would not be able to maintain its internal environment, which is crucial for its survival. Without selective permeability, the cell would be unable to regulate the amount of nutrients it takes in, which could lead to an excess or deficiency of certain nutrients.
Second, the cell would not be able to carry out its normal functions, such as metabolism and energy production. This is because the cell relies on the proper balance of nutrients to carry out these processes.
Lastly, the cell would be unable to communicate with other cells, which is important for coordinating cellular activities and responding to signals from the environment.

To know more about cell membranes refer here:

https://brainly.com/question/13524386

#SPJ11

Question 14
What are the methods that have been used by evolutionary biologists to demonstrate the occurrence of natural selection? (Select all that apply) - Observing & reporting the change of phenotype distribution in natural populations. - Establishing & analyzing the change of phenotype distribution in experimental populations in the laboratories. - Establishing & analyzing the change of phenotype distribution in experimental populations in the nature. - Using computer simulation to observe & analyze the change of phenotype distribution in virtual populations. Question 15
Which of the following statements about Darwinian fitness is correct? (Select all that apply) - A cod lays 20000 eggs in its lifetime has a very high Darwinian fitness. - Darwinian fitness is the differential reproduction & survivorship of individuals in a population. - Darwinian fitness is about the survival of the fittest. Individuals with high Darwinian fitness always have high physical fitness. - A salmon has greater Darwinian fitness than an elephant because the former can lay 2000 eggs a day, yet the latter only gives birth to 1 young per 8 years. - The best measurement of Darwinian fitness is the number of surviving offspring left in the next generation over lifetime. Question 16
Which of the following statements about natural selection is correct? (Select all that apply) - Natural selection make organisms 'perfect for their living environments. - Natural selection is not an active power because selection is random. - Natural selection is not purpose-oriented or goal-seeking. - Natural selection acts on individuals, but its consequences occur in populations. - Natural selection is an active power because selection is not random.

Answers

Evolution in the study of biology means changes in the inherited characteristics of a population of organisms from one generation to the next.

This question consists of 3 parts, the answer is:

Question 14:
Methods that have been used by evolutionary biologists to demonstrate the occurrence of natural selection include: observing and reporting the change of phenotype distribution in natural populations; establishing and analyzing the change of phenotype distribution in experimental populations in the laboratories; using computer simulation to observe and analyze the change of phenotype distribution in virtual populations.
Question 15:
Correct statements about Darwinian fitness include: Darwinian fitness is the differential reproduction and survivorship of individuals in a population; Darwinian fitness is about the survival of the fittest; the best measurement of Darwinian fitness is the number of surviving offspring left in the next generation over a lifetime.
Question 16:
Correct statements about natural selection include natural selection is not an active power because the selection is random; natural selection is not purpose-oriented or goal-seeking; natural selection acts on individuals, but its consequences occur in populations.

Learn more about evolutionary biologists at https://brainly.com/question/27745952

#SPJ11

What is the fluid found within the body's cells called?

Answers

The fluid found within the body's cells is called cytosol. It is a gel-like substance that makes up the majority of the cell's volume.

It is composed of water, salts, and organic molecules, and it is where many of the cell's metabolic reactions occur. The cytosol is also where the cell's organelles, such as the mitochondria and endoplasmic reticulum, are suspended.
In addition to its role in metabolism, the cytosol also plays a role in cell signaling and communication. It is involved in the transmission of signals between cells and in the regulation of cellular processes.
In summary, the cytosol is a crucial component of the cell, playing a role in metabolism, signaling, and communication.

For more question on cytosol click on

https://brainly.com/question/174023

#SPJ11

During an equinox, the Sun appears to travel across the horizon at the poles. Draw or explain the position of Earth in relation to the Sun that causes this to happen.

Answers

At equator Sun appears directly overhead at noon during the equinox, while at higher latitudes the angle of incidence of the Sun's rays changes gradually throughout the day.

What is Pole?

However, there are some other types of poles in physics that can be located near the equator. For example, in electrostatics, a pole refers to a point where the electric field lines converge or diverge. These poles can occur near electrically charged objects, and they are not limited to any particular location on the Earth's surface.

An equinox occurs when the Earth's axis is tilted neither toward nor away from the Sun, resulting in nearly equal amounts of daylight and darkness at all latitudes. During an equinox, the position of the Earth in relation to the Sun is such that the Sun appears to travel across the horizon at the poles.

To understand why this happens, imagine the Earth as a tilted sphere with its axis of rotation passing through the North and South Poles. During the equinox, the axis of rotation is perpendicular to the line connecting the Earth and the Sun. This means that the Sun's rays are hitting the Earth's equator directly, and the angle of incidence of the Sun's rays is the same at all latitudes.

Learn more about Pole from given link

https://brainly.com/question/14997726

#SPJ1

A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.
Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'
Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'
Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3'

Answers

a. The type of mutаtion in cаncer pаtient 1 is а deletion mutаtion, where one nucleotide (C) is deleted from the sequence.

b. The type of mutаtion in cаncer pаtient 2 is а substitution mutаtion, where one nucleotide (C) is substituted with аnother nucleotide (А).

Deletion mutаtion cаn cаuse а frаmeshift mutаtion, where the reаding frаme of the codons is shifted аnd cаn result in а completely different protein being produced. Substitution mutаtion cаn result in а missense mutаtion, where one аmino аcid is chаnged in the protein, or а silent mutаtion, where the аmino аcid remаins the sаme despite the chаnge in nucleotide.

The effect of these mutаtions on the protein will depend on the specific аmino аcid chаnge аnd its locаtion in the protein. А frаmeshift mutаtion cаn result in а nonfunctionаl protein, while а missense mutаtion cаn result in а protein with аltered function. А silent mutаtion will hаve no effect on the protein.

For more information about mutаtions refers to the link: https://brainly.com/question/17130462

#SPJ11

What agar plate has a media heated 80 Celsius with nutrients like beff extract and low peptone concentration and allows the fastidious pathogens growth?

Answers

The agar plate that has a media heated at 80 degrees Celsius with nutrients like beef extract and low peptone concentration and allows the fastidious pathogens growth is known as the Chocolate Agar Plate.

The Chocolate Agar Plate is a type of enriched agar that contains a heat-treated blood supplement, usually from sheep or horse blood. The heat treatment at 80 degrees Celsius lyses the red blood cells and releases the intracellular nutrients, including hemin and NAD, which are essential for the growth of fastidious pathogens. The beef extract and low peptone concentration provide additional nutrients to support the growth of these organisms.

The Chocolate Agar Plate is commonly used for the isolation and cultivation of fastidious pathogens, such as Haemophilus influenzae, Neisseria gonorrhoeae, and Streptococcus pneumoniae. These organisms require the additional nutrients provided by the heat-treated blood supplement in order to grow on the agar plate.

In summary, the Chocolate Agar Plate is a type of enriched agar that is specifically designed to support the growth of fastidious pathogens. It contains a heat-treated blood supplement, beef extract, and low peptone concentration, which provide the necessary nutrients for these organisms to grow.

Here you can learn more about Chocolate Agar Plate

https://brainly.com/question/14466286#

#SPJ11

compare the structure of a striated muscle cell with that of a
smooth muscle cell and a cardiac muscle cell.

Answers

The structure of a striated muscle cell differs from that of a smooth muscle cell and a cardiac muscle cell in several ways.

Striated muscle cells, also known as skeletal muscle cells, have a cylindrical shape and are multinucleated. They have a banded appearance due to the presence of sarcomeres, which are the functional units of muscle contraction. These sarcomeres are made up of thick and thin filaments, which are responsible for the striated appearance of the cell.

Smooth muscle cells, on the other hand, have a spindle shape and are uninucleated. They do not have sarcomeres and therefore do not have a striated appearance. Instead, they have a network of actin and myosin filaments that are responsible for contraction.

Cardiac muscle cells are similar to striated muscle cells in that they have sarcomeres and a striated appearance. However, they are branched and have only one or two nuclei. They also have intercalated discs, which are specialized junctions that allow for the coordinated contraction of the heart.

In summary, striated muscle cells have a cylindrical shape, multiple nuclei, and sarcomeres, while smooth muscle cells have a spindle shape, one nucleus, and no sarcomeres. Cardiac muscle cells have a branched shape, one or two nuclei, sarcomeres, and intercalated discs.

You can learn more about striated muscle cell at

https://brainly.com/question/13018987

#SPJ11

1. Answer the following characteristics for Basidiomycota
Fungi.
A. Color
B. Texture
C. Form
D. Size
E. Starch storage (where)

Answers

Basidiomycota fungi:

A. Color: white, yellow, purple, brown, or black. B. Texture: slimy, leathery, scaly, hoof-like, or gelatinous. C. Form: multicellular and can range from being single-celled to being formed in intricate structures. D. Size: vary greatly in size, from single-celled organisms to large mushrooms. E. Starch storage (where): store starch in their cell walls and in their cytoplasm.

Basidiomycota is a phylum of fungi that is characterized by its unique features.  
1. Answer the following characteristics for Basidiomycota Fungi.

A. Color: The color of the fruiting body of Basidiomycota fungi can range from white, brown, orange, or black depending on the species. Some species are bioluminescent and can emit light in the dark.

B. Texture: The texture of the fruiting body of Basidiomycota fungi can vary depending on the species. Some have a smooth surface, while others have a rough or scaly surface.

C. Form: The fruiting body of Basidiomycota fungi can take various forms, including mushrooms, brackets, or puffballs.

D. Size: The size of the fruiting body of Basidiomycota fungi can vary depending on the species. Some can be very small, while others can be very large.

E. Starch storage (where): Basidiomycota fungi store starch in their mycelium. The mycelium is a network of filaments that are responsible for absorbing nutrients from the environment.

For more such questions on Basidiomycota Fungi.

https://brainly.com/question/1078841#

#SPJ11

Write down your question about how the world works, or,
alternatively, you can write down your hypothesis about how the
world works for class BIOL-100-OMH-CRN30873

Answers

I can provide some tips on how to come up with a question or hypothesis about how the world works for your class.

1. Think about what interests you in the field of biology and what you are curious about. This can help guide your question or hypothesis.

2. Make sure your question or hypothesis is specific and measurable. Avoid broad or vague questions or hypotheses.

3. Consider what you already know about the topic and what you want to learn more about. This can help you come up with a question or hypothesis that is relevant and meaningful to you.

4. Make sure your question or hypothesis is testable and can be answered or supported with evidence.

1. When generating a question or hypothesis about how the world works, it's important to start with your personal interests and curiosities in the field of biology.

This can help you create a question or hypothesis that you are genuinely interested in exploring and will be more motivated to research and understand.

2. It's crucial to ensure that your question or hypothesis is specific and measurable. Broad or vague questions or hypotheses can lead to unclear or inconclusive results.

By making your question or hypothesis specific and measurable, you can more easily design experiments or gather evidence to support your findings.

3. Your prior knowledge and understanding of the topic is an important factor to consider when developing a question or hypothesis.

This can help you identify gaps in your understanding and focus your research on areas where you need more information or clarification.

4. A testable question or hypothesis is essential for conducting scientific research. A testable question or hypothesis is one that can be supported or refuted by evidence.

By making your question or hypothesis testable, you can gather data and draw meaningful conclusions based on the evidence you collect.

To know more about hypothesis click on below link:

https://brainly.com/question/17173491#

#SPJ11

You self-fertilize a pea plant that is heterozygous for three genes controlling height, seed shape, and seed color with the dominant alleles being tall (T), round (R), and yellow (Y) and the recessive alleles are short (t), wrinkled (r), and green (y). What is the probability that an offspring will be tall with wrinkled, yellow seeds?

Answers

The probability that an offspring will be tall with wrinkled, yellow seeds is 1/16 or 0.0625.

To determine the probability of this specific phenotype, we need to consider the inheritance of each trait independently.

First, we consider the inheritance of height. Since the parent plant is heterozygous (Tt), there is a 50% chance that each offspring will receive the dominant allele for height (T) and be tall.

Next, we consider the inheritance of seed shape. Since the parent plant is heterozygous (Rr), there is a 25% chance that each offspring will receive the recessive alleles for seed shape (rr) and be wrinkled.

Finally, we consider the inheritance of seed color. Since the parent plant is heterozygous (Yy), there is a 25% chance that each offspring will receive the dominant alleles for seed color (YY or Yy) and be yellow.

By multiplying these probabilities together (0.5 x 0.25 x 0.25), we get a probability of 0.0625 or 1/16 that an offspring will be tall with wrinkled, yellow seeds.

For more questions like Probability visit the link below:

https://brainly.com/question/30827786

#SPJ11

Read the article by Taub, 2010 and answer the DQs to Unit -6. What is photosynthesis? Discuss the impact of increasing global CO2 levels on photosynthesis. How different photosynthetic plant type (C3 and C4) will respond to increase in CO2. Which plant will be benefitted more C3 or C4? Why?

Answers

Read the article by Taub, 2010 and the DQs to Unit -6. Photosynthesis is convert light energy from the sun into chemical energy in the form of glucose

The impact of increasing global CO2 levels on photosynthesis is increased rates of photosynthesis.

The different photosynthetic plant type (C3 and C4) will respond to increase in CO2 is C3 plants use the Calvin cycle to fix carbon and C4 plants use an additional step to concentrate CO2

The plant which will be benefitted more is C4 plants because adapted to efficiently use CO2

Photosynthesis is the process by which plants, algae, and certain types of bacteria convert light energy from the sun into chemical energy in the form of glucose or sugar. The equation for photosynthesis is 6CO2 + 6H2O + light energy → C6H12O6 + 6O2.

The impact of increasing global CO2 levels on photosynthesis is complex. On one hand, higher levels of CO2 can lead to increased rates of photosynthesis, as CO2 is one of the key ingredients in the process. However, other factors such as temperature, water availability, and nutrient availability can also impact photosynthesis, and may limit the benefits of increased CO2 levels.

Different photosynthetic plant types, specifically C3 and C4 plants, will respond differently to an increase in CO2. C3 plants, which include most trees and many crops, use the Calvin cycle to fix carbon during photosynthesis. C4 plants, which include many grasses and some crops, use an additional step to concentrate CO2 before it enters the Calvin cycle. As a result, C4 plants are generally more efficient at photosynthesis under high CO2 levels.

Overall, it is likely that C4 plants will benefit more from an increase in CO2 levels than C3 plants. This is because C4 plants are already adapted to efficiently use CO2, and may be better able to take advantage of the increased levels. However, it is important to note that other factors, such as temperature and water availability, will also play a role in determining the overall impact of increased CO2 levels on plant growth and photosynthesis.

Learn more about photosynthesis at:

https://brainly.com/question/29775046

#SPJ11

Other Questions
CEREAL A company claims that its boxes of cereal contain 19.1 ounces ofcereal. The actual amount of cereal in the box can be within 0.5 ounce of theadvertised amount. What is the range of possible amounts of cereal c in a box? what is the nth term a_(n) of the geometric sequence with a_(1)=4 r=(1)/(2) and n=5 Please help will give brainilest Factor completely and then place the factors in the proper location on the grid.b + 12b + 32 what is the meaning of the word accure as it is used in paragraph 5 Meena had a piece of fabric. She cut 2/9 of her fabric and used 8/9 of that piece for an art project. What fraction of her fabric did she use for her art project? 15 POINTS IF CORRECT!!!! Fran Jefferson began her job as the supervisor of the training department of Metro Bank and Trust Company almost four years ago, she was generally pleased with the four trainers and one secretary in her unit. Indeed, Fran took pride in her ability to create a high morale and high-performance unit. This was particularly pleasing to Fran because they were constantly busy and barely able to keep up with the volume of training expected from them. Then early on Wednesday morning Frans secretary, Judy Martin knocked on Frans door and asked to see her. Fran Liked Judy and considered the secretary to be one of her "stars." Indeed, in an effort to develop Judys talents and abilities, Fran had gone out of her way to give Judy special assignments, including her in all the major planning activities of the department and entrusting her with the administration of certain departmental programs, such as tuition assistance and evaluation follow-through. By now Judy functioned more as an administrative aide than as a secretary. It was clear that Judy was upset about something as she seated herself in the chair next to Frans desk. Slowly, Judy placed a job-posting application form in front of Fran. She would not look her supervisor in the eyes. Fran was surprised, to say the least. As far as Fran knew, Judy liked both her hob and working in the Training Department. In turn, everyone else in the department liked and respected Judy. Fran looked over the form and said casually, "so you want to post for the executive secretary job in the Branch Management Division." She paused. Could I ask you for some additional information, Judy? Im kind of surprised." Judy looked at her clasped hands, thinking. Fran waited. Finally, Judy looked up and said: "I noticed in last weeks job posting that the executive secretary position is graded as a 14. Now thats two grades higher than my job!" She caught her breath. "You know my friend Mary Johnson works over there. She told me that half the time the secretary sits around doing nothing." Judy continued, Gathering some anger in her look and resentment in her voice. "Look, Fran, you know how hard I work, how hard we all work, around here. I mean. Im always busy. I dont see why I should work in a job graded at a 12 and work twice as hard and yet not be paid the same as that secretary. The job requirements for the job are just a little higher than mine and the merit raise you gave me last month hardly helped at all." Fran listened; then she replied: "It sounds to me, Judy, that youre feeling angry because you think you should be paid more for the work you do and that you want to switch jobs rather than put up with things as they are. Am I right?" Judy nodded her head in agreement. Fran knew, though, that the Metro hob evaluation system was up to date and that the executive secretary position to which Judy referred did require additional background experience, skills, and responsibilities beyond what was needed in Judys current hob. Because her secretary was such a good employee and nice person, Fran was quite concerned. She felt strongly that moving to the executive secretary job would not be what Judy really wanted, and she hated to lose Judy, especially her decision was based on faulty reasoning and the move would not be good for her.Help me to answer these 3 questions, please.1. What is/ are the problem/s presented in the case?2. What HR responsibility/ responsibilities of a line manager does Fran need to focus on to solve the problem/s in this case?3. What HR activities/ programs can you recommend to be implemented in the organization in order to prevent these problems from happening again? what drives johns forefathers to protect people from the truth and create a lie in by the waters of babylon Consider the parabola represented by this equation.4x2 + 4x + 2y + 1 = 0Which features are features of the parabola?0opens downopens to the leftdirectrix at y = vertex at (-1,0)directrix at x =02/00HELPPPP MEEEW How is Odysseuss triumph possible, and how does the term Mtis relate to his success? In the fruit fly Drosophila melanogaster, the following genes and mutations are known:Wing size: recessive allele for tiny wings t;; dominant allele for normal wings TEye shape: recessive allele for narrow eyes n dominant allele for normal (oval) eyes NFor each of the four following crosses, give the genotypes of each of the parents. If a line passes through the points (1,2) and (0.5,1), what is the distance between the x and y intercepts of that line? (A) 13/6 (B) 13/2 (C) 213/3 (D) 313/2 (E) None of these Which object has the greatest kinetic energy? A. a truck with a mass of 3,500 kg moving at 30 m/s B. a fast pitched baseball with a mass of .5 kg moving at 46.9 m/s C. a locomotive engine with a mass of 205,000 kg moving 5 m/s D. a person with a mass of 73 kg running 6 m/s What is ionizing radiation? A. electromagnetic radiation in the infrared region B. electromagnetic radiation with energy low enough to damage cells C. electromagnetic radiation in the visible light region D. electromagnetic radiation with high enough energy to damage cells Recommend two strategies thta girls could implement to challenge gender stereotypes within the school Evaluate:8power of 8/3 Question You own a bond with a par value of $1.000 and a coupon rate at man couponi. You know it has a content yield of 2.75%. What is to ol yield to maturity? The bond has 10 years to maturity Current Yield annual payment/pricel hint solve for price to answer the questionA.12.93%B.92.68%C.9.88D.12.739E.8.75 Find z_{0} such that P(z_{0} < z < 2.2) = 0.7258 Use a TI T - 83Plus / T * 1 - 84 Plus calculator and round the answer to at least four decimal places z_{0} = It is method used to color wood to give an illusion of texture A new automobile is purchased for $20,000. If V = 20,000(0. 8)x, gives the cars value after x years, about how long will it take for the car to be worth $8,200?