1) If the economy is in a recession and the president invites three economists of different school of thoughts —A Monetarist, a Supply-side Economist, and a Rational Expectation Theorist —to offer explanation and economic policy options, what would each say in two sentences or less?
- Monetarist:
- Supply-side Economist:
- Rational Expectation Theorist:
2) Between the crises of 1930s and 2008, what are (mention two for each):
a) the similarities?
b) the differences?
3) If you were an influential economist, to prevent deep recessions in the future, what policies/thoughts would you offer?

Answers

Answer 1

A monetarist would say that the recession is caused by a decrease in the money supply, and the solution is to increase the money supply through monetary policy. They would recommend lowering interest rates and engaging in quantitative easing to stimulate the economy.



A supply-side economist would argue that the recession is caused by a decrease in production and the solution is to increase production through supply-side policies. They would recommend lowering taxes and reducing regulations to stimulate business investment and production.

A rational expectation theorist would argue that the recession is caused by people's expectations about the future, and the solution is to change those expectations. They would recommend implementing credible policies that will convince people that the economy will improve in the future.

Similarities between the crises of 1930s and 2008:
- Both were caused by a collapse in the financial system, leading to a decrease in lending and investment.
- Both resulted in high unemployment rates and a decrease in economic output.

Differences between the crises of 1930s and 2008:
- The 1930s crisis was caused by a decrease in the money supply, while the 2008 crisis was caused by a housing bubble and risky financial practices.
- The 1930s crisis lasted longer and had a deeper impact on the economy, while the 2008 crisis was shorter and had a less severe impact.

As an influential economist, I would recommend implementing policies that promote long-term economic stability and prevent financial crises. This could include implementing stricter regulations on the financial system to prevent risky practices, maintaining a stable money supply, and promoting sustainable economic growth through investment in education and infrastructure.

Supply-side economics is a school of thought that first gained popularity in the 1970s. Its analysis concentrated on how taxes affected important macroeconomic indicators like output, employment, inflation, and income.

To learn more about supply side economics, visit:

brainly.com/question/3333330

#SPJ11


Related Questions

Rebecca pays $8,000 per month in rent to operate a restaurant in Charlotte. She also pays $17,000 per month in wages, $3,000 per month in food and supplies, and $1,000 per month in insurance. All of her costs of production, except her insurance and rent, can change if she makes different decisions about her restaurant production. Rebecca's monthly sunk costs equal:
Question 2 options:
a)
$11,000.
b)
$9,000.
c)
$29,000.
d)
$20,000.

Answers

The correct answer to Rebecca's monthly sunk costs equal is: option b) $9,000.

Sunk costs are costs that have already been incurred and cannot be recovered. In the case of Rebecca's restaurant, her sunk costs are the costs that she cannot change or recover, which are her insurance and rent costs. Therefore, to calculate her monthly sunk costs, we simply need to add her insurance and rent costs together:

$8,000 (rent) + $1,000 (insurance) = $9,000

So, Rebecca's monthly sunk costs equal $9,000.

In conclusion, sunk costs are costs that cannot be recovered or changed. In the case of Rebecca's restaurant, her sunk costs are her insurance and rent costs, which total $9,000 per month. Therefore, the correct answer is option b) $9,000.

To know more about sunk costs refer here:

https://brainly.com/question/29488541#

#SPJ11

Which country's chief executive is part of the legislative branch?

Answers

Israel chief executive is also part of the legislative branch of its government because he is required to be a member of the Knesset, the country's unicameral legislative body.

How is Isreal chief executive part of the legislative branch?

Israel has a parliamentary system of government in which the chief executive, known as the Prime Minister, is a member of the Knesset, the country's unicameral legislative body. The Prime Minister is elected by the Knesset and is responsible for appointing other members of the government, including ministers and deputy ministers.

The President of Israel, who is a largely ceremonial role, is elected by the Knesset as well. In Israel's parliamentary system, the executive and legislative branches are closely intertwined, with the Prime Minister and other members of the government being accountable to the Knesset.

Read more about legislative branch

brainly.com/question/30773744

#SPJ1

Eugene "Bull" Connor, the commissioner of public safety in Birmingham in the 1960s,

Answers

It is a true statement that Eugene Bull Connor served as Public Safety Commissioner of Birmingham in the 1960s.

What did Bull Connor do in Birmingham?

Bull Connor, an ardent segregationist who served as Birmingham, Alabama's commissioner of public safety for 22 years, used his administrative authority over the police and fire departments to ensure that Birmingham remained "the most segregated city in America," as Martin Luther King put it.

He was a member of the Democratic Party, he strongly opposed the Civil Rights Movement in the 1960s. Connor's and his police force's violent response to protests during the Birmingham Campaign in 1963 catapulted the civil rights movement into the national spotlight.

Full question "Eugene "Bull" Connor, the commissioner of public safety in Birmingham in the 1960s True/False"

Read more about Bull Connor

brainly.com/question/15100873

#SPJ1

What and why subsidy is a direct or indirect payment to
individuals or firms, usually in the form of a cash payment from
the government or a targeted tax cut. In economic theory, subsidies
can be used

Answers

A subsidy is a direct or indirect payment to individuals or firms, usually in the form of a cash payment from the government or a targeted tax cut.

Subsidies are used in economic theory to encourage certain behaviors or to support certain industries or sectors of the economy. For example, subsidies may be used to encourage businesses to invest in new technology or to support farmers and other agricultural producers.

Subsidies can also be used to help consumers afford certain goods or services, such as healthcare or education. The goal of a subsidy is typically to promote economic growth and stability, or to achieve other social or economic objectives.

However, subsidies can also have negative effects, such as distorting markets and creating inefficiencies. Therefore, it is important for governments to carefully consider the potential costs and benefits of subsidies before implementing them.

To know more about subsidy refer here:

https://brainly.com/question/29786096#

#SPJ11

I am doing a detailed strategic analysis on PPG Industries.
Please give the external analysis for PPG Industries.
Please Include
-Opportunity & threats, PESTEL, Porter’s five
forces, strategic

Answers

Strategic Analysis in This analysis looks at the current strategy of the company and how it can be improved to gain a competitive advantage. It includes analyzing the company’s objectives, strengths, weaknesses, and opportunities in the market.

The external analysis for PPG Industries includes an assessment of opportunities and threats, a PESTEL analysis, Porter’s five forces, and a strategic analysis.

Opportunities and Threats: PPG Industries has the opportunity to expand their product offerings and attract new customers. They also have the opportunity to use their existing brand equity to develop their online presence. Some of the threats that the company faces include increased competition from other companies in the industry and the potential for changing customer preferences.

PESTEL Analysis: This analysis looks at the political, economic, social, technological, environmental, and legal factors that may affect PPG Industries.

Political: Political factors include government regulations, taxes, and trade policies that can affect the company.Economic: Economic factors include the overall economic growth, inflation, unemployment, and interest rates.Social: Social factors include customer preferences, spending trends, and the cultural environment. Technological: Technological factors include the availability of new technologies, digitalization, and cyber security. Environmental: Environmental factors include climate change, pollution, and sustainability. Legal: Legal factors include government laws and regulations that affect the company.

Porter’s Five Forces: Porter’s Five Forces is an analysis of the competitive forces in the industry. These forces include the threat of new entrants, the bargaining power of buyers, the bargaining power of suppliers, the threat of substitutes, and the intensity of rivalry among existing competitors.

Learn more about Strategic Analysis: https://brainly.com/question/29841727

#SPJ11

Fill in the blank. When someone tells you to adjust your posture so that you can communicate confidence, they are noting the importance of___in nonverbal communication

Answers

When someone tells you to adjust your posture so that you can communicate confidence, they are noting the importance of body language in nonverbal communication.

While effective communication is essential for achieving success in both personal and professional relationships, nonverbal cues—also known as "body language"—speak louder than words every time. Body language, which is frequently done automatically rather than intentionally, is the use of physical behaviour, expressions, and mannerisms to communicate nonverbally. Whether you realise it or not, you constantly send and receive nonverbal cues when you connect with others. Your body language, posture, tone of voice, amount of eye contact, and gestures all convey a lot of information nonverbally.

Learn more about nonverbal communication here:

https://brainly.com/question/28517848

#SPJ4

Which kind of democracy was taking place in the 1960s during the Civil Rights Movement and saw active citizens marching for change
A pluralist democracy
B Development democracy
C Protective democracy
D Participatory democracy

Answers

Correct answer is D, Participatory democracy was taking place in the 1960s during the Civil Rights Movement and saw active citizens marching for change.

The kind of democracy that was taking place in the 1960s during the Civil Rights Movement and saw active citizens marching for change was a liberal democracy. Liberal democracy is a form of representative democracy that is characterized by a commitment to individual rights, civil liberties, and political equality.

During the Civil Rights Movement, citizens were demanding equal rights and opportunities, as well as an end to discriminatory laws and practices that had been entrenched in American society for generations. They used various tactics, including marches, sit-ins, boycotts, and other forms of civil disobedience, to bring attention to their cause and put pressure on government officials to enact change.

These efforts were grounded in the principles of liberal democracy, which holds that every individual should have the right to participate in the political process, have equal protection under the law, and be free from discrimination based on their race, gender, religion, or other characteristics. Through their activism, citizens of all races and backgrounds were able to bring about significant social and political changes, including the passage of landmark civil rights legislation such as the Civil Rights Act of 1964 and the Voting Rights Act of 1965.

To learn more about Participatory democracy  from given link

https://brainly.com/question/29547280

#SPJ1

For each fraction, select the most appropriate estimate. 36 40 Choose... 1 3 Choose... 70 100 Choose... 1 8 Choose...

Answers

Answer:

For the fraction 36/40, the most appropriate estimate is 9/10 (which is equivalent to 90/100).

For the fraction 1/3, the most appropriate estimate is 33/100.

For the fraction 1/8, the most appropriate estimate is 12/100 or 3/25.

Explanation:


I neeeeed help I will give brainlest to the first!!!!!

Answers

Answer:

The correct answers are

Most Southern communities refused to integrate schools.

Some communities closed their schools rather than integrate.

Explanation:

You were correct!

How did Americans respond after hearing about Standard Oil’s secret business practices?

They admired the company’s ability to get ahead in the oil industry.
They held demonstrations and refused to do business with the company.
They sold their oil refineries to Standard Oil to increase its monopoly.
They formed a pact to support Standard Oil and keep it from breaking up.

Answers

Answer:

They held demonstrations and refused to do business with the company.

plssssssssss help meeeeeeee

Answers

Answer:

if white and black suffragists worked together, everyone would benefit.

Explanation:

"we are all bound up together..." meaning, lets not let superfical differences divide us. "society cannot trample on the weakest....without receiving the same curse"- if white women ignore (trample) the needs of the weakest (Black) they will continue facing the same curse of not being allowed to vote.

A senior economist in your country makes the following assertion: "Growth prospects in our country have been severely negatively impacted as the country has consistently opened up to global imports". Critically evaluate this claim with the concepts you have learnt in class. Be as conceptually specific as you can be when you make your argument for/against the statement.

Answers

The assertion made by the senior economist can be evaluated by examining the impact of global imports on the economy of a country.

On one hand, opening up to global imports can lead to an influx of cheaper goods and services, which can increase consumer spending and stimulate economic growth. However, on the other hand, it can also lead to domestic industries facing increased competition from foreign companies, which can lead to job losses and a decrease in economic growth.

One concept that can be used to evaluate this claim is the idea of comparative advantage. This concept suggests that countries should specialize in the production of goods and services that they can produce most efficiently, and trade with other countries to obtain goods and services that they cannot produce as efficiently. In this case, if a country has a comparative advantage in the production of certain goods and services, opening up to global imports can allow it to specialize in these areas and increase its economic growth.

Another concept that can be used to evaluate this claim is the idea of protectionism. Protectionism is the practice of restricting trade with other countries in order to protect domestic industries from foreign competition. While this can help to protect domestic industries and jobs, it can also lead to higher prices for consumers and a decrease in economic growth.

Overall, the impact of opening up to global imports on a country's growth prospects is a complex issue that requires careful consideration of the potential benefits and costs. While it can lead to an increase in consumer spending and economic growth, it can also lead to job losses and a decrease in economic growth. Therefore, it is important to consider the specific circumstances of a country before making a conclusion about the impact of global imports on its growth prospects.

Learn more about imports https://brainly.com/question/30057318

#SPJ11

In the developing nations, a wide rage of policies options to reduce, if not eliminate, poverty and to alter the nation’s size distribution of national income have been implemented. Which policies do you
believe are absolutely essential and proved to be effective? Explain whether these policies have
specifically targeted the high poverty groups (e.g. rural, women, elderlies, minorities, etc.)! (You may
choose a specific developing nation as your example). Support your arguments with relevant evidences from related researches.

Answers

The most essential and effective policies in developing nations are an investment in education, infrastructure development, social safety nets, and economic growth.

What Are The Most Essential Policies In Developing Nations?

There are a variety of policy options that have been implemented in developing nations to reduce poverty and alter the distribution of national income. Some of the most essential and effective policies include:

Investment in education and human capital: This is essential for reducing poverty, as it allows individuals to gain the skills and knowledge necessary to secure higher-paying jobs and increase their income. This policy can specifically target high poverty groups, such as women and minorities, by providing targeted educational programs and scholarships.Infrastructure development: Investing in infrastructure, such as roads, transportation, and communication networks, can help to reduce poverty by improving access to markets and economic opportunities. This policy can also specifically target rural areas, which often lack adequate infrastructure and are therefore more likely to experience poverty.Social safety nets: Providing social safety nets, such as cash transfers and food assistance, can help to reduce poverty by providing basic necessities and helping individuals to meet their basic needs. This policy can specifically target vulnerable groups, such as the elderly and those living in extreme poverty.Economic growth: Promoting economic growth is essential for reducing poverty, as it creates jobs and increases incomes. This policy can specifically target high poverty groups by promoting inclusive growth that benefits all members of society.

Learn more about developing nations at https://brainly.com/question/1518893

#SPJ11

Explain thoroughly why and how the Stolper-Samuelson effect results. (Note: a thorough explanation that links a change in the relative price of a good to changes in factor intensities of the two goods, and, in turn, changes in marginal products and real incomes of the two factors is needed for this question. No diagram is needed.)

Answers

The optimal degree of product variety is influenced by a variety of factors, and companies must consider these factors when deciding how many products to offer.

The Stolper-Samuelson effect is a result of changes in the relative prices of goods, which leads to changes in the factor intensities of the two goods and, in turn, changes in the marginal products and real incomes of the two factors. This effect is explained through the Heckscher-Ohlin model, which is used to analyze the impact of trade on the distribution of income within countries.

The Stolper-Samuelson effect occurs when there is a change in the relative price of a good. This change in price leads to a change in the factor intensities of the two goods. For example, if the price of a good that is labor-intensive increases, then the demand for labor will increase, leading to an increase in the wage rate. Similarly, if the price of a good that is capital-intensive increases, then the demand for capital will increase, leading to an increase in the return on capital.


As the factor intensities of the two goods change, there will also be changes in the marginal products of the two factors.

The marginal product of labor will increase in the labor-intensive good and decrease in the capital-intensive good. Similarly, the marginal product of capital will increase in the capital-intensive good and decrease in the labor-intensive good.These changes in marginal products will lead to changes in the real incomes of the two factors. The real income of labor will increase in the labor-intensive good and decrease in the capital-intensive good. Similarly, the real income of capital will increase in the capital-intensive good and decrease in the labor-intensive good.

Learn more about product variety: https://brainly.com/question/29910613

#SPJ11

Q.1 Externalities – fill in the gaps Negative externalities are external c________________ on th____________ p_____________ (people who did not consume or produce the good). They can come from p________________ or c_____________________. It causes market failure because the consumer or producer only c_____________ his private costs and benefits and does not c__________________ the external costs. The market p__________________ does not therefore reflect the true cost of the good or service. The p_________________ c_______________ plus the e________________ c____________ equals the s__________________ c______________________. Therefore, at fr______________ m____________________eq_____________________, the total (social) c__________________ are still higher than the total (social) b______________________. In other words, the free market delivers an inefficient allocation of resources (costs are more than benefits)

Answers

"Negative externalities are external costs on the third parties (people who did not consume or produce the good). They can come from production or consumption. It causes market failure because the consumer or producer only considers his private costs and benefits and does not consider the external costs. The market price does not therefore reflect the true cost of the good or service. The private cost plus the external cost equals the social cost. Therefore, at free market equilibrium, the total (social) costs are still higher than the total (social) benefits. In other words, the free market delivers an inefficient allocation of resources (costs are more than benefits)."

Negative externalities refer to the costs incurred by third parties due to the production or consumption of goods and services by others. For instance, pollution from a factory may affect the health of nearby residents. These costs are not reflected in the market price of the good or service, causing an inefficient allocation of resources. This is because producers and consumers only consider their private costs and benefits, and not the external costs that society bears.

As a result, the social cost of producing or consuming a good is higher than its private cost. To address negative externalities, governments can use policies like taxes, subsidies, and regulations to internalize the external costs and promote a more efficient allocation of resources.

Learn more about Negative externalities https://brainly.com/question/13901028

#SPJ11

Country A's income receipts are $300 billion, and income payments are $250 billion. Despite this, country A is a debtor nation. How can country A receive more income than it paid out? Use the formula to answer the question.

Answers

Country A can receive more income than it paid out because income receipts and payments are only one part of a country's financial transactions. A country's overall financial status also includes its trade balance, net transfers, and net foreign investment.

The formula to calculate a country's overall financial status is:
Overall financial status = Trade balance + Income balance + Net transfers + Net foreign investment
In this case, even though Country A's income receipts are higher than its income payments ($300 billion - $250 billion = $50 billion income balance), it may have a negative trade balance, negative net transfers, and negative net foreign investment that outweigh the positive income balance. This would result in Country A being a debtor nation overall.

For such more question on income:

https://brainly.com/question/25745683

#SPJ11

Which quote from the text is an example of using logos to promote the idea of woman suffrage?

“To keep a foothold in society, woman must be as near like man as possible, reflect his ideas, opinions, virtues, motives, prejudices, and vices.”
“Society is but the reflection of man himself, untempered by woman's thought; the hard iron rule we feel alike in the church, the state, and the home.”
“People object to the demands of those whom they choose to call the strong-minded, because they say ‘the right of suffrage will make the women masculine.’”
“A government of the most virtuous educated men and women would better represent the whole and protect the interests of all than could the representation of either sex alone.”

Answers

To illustrate how logos can be used to support the idea of women's suffrage, consider the following text quote: “To keep a foothold in society, woman must be as near like man as possible, reflect his ideas, opinions, virtues, motives, prejudices, and vices.”

Explain about logos used to promote woman suffrage?

The women's suffrage movement's founders understood early on that symbolism was necessary to assist them convey their message and make it remember.

It took a long time for the movement to succeed. Both men and women in my family have either actively fought for or supported suffrage. When one of the great grandmothers contacted to Susan B. Anthony to inquire what she could do to help the cause, she was a student. She organized supporters, marched, went to conventions, but she was never given the chance to cast a ballot. Purple, white, and gold were adopted by the Congressional Union for Women's Suffrage when it was founded in 1913.

Thus, to illustrate how logos can be used to support the idea of women's suffrage, consider the following text quote:

She must be as much like man as possible, mirror his thoughts, attitudes, virtues, impulses, prejudices, and vices, in order to maintain a foothold in society.

know more about woman suffrage

https://brainly.com/question/751172

#SPJ1

Social responsibility is not business's intent to pursue as a
long-term goal that may be good for society.
True
or
False

Answers

False. Social responsibility is indeed a business's intent to pursue long-term goals that are good for society.

It involves making ethical and sustainable choices that benefit not just the business itself, but also the community, environment, and stakeholders. By being socially responsible, businesses can improve their reputation, attract customers, and retain employees. Social responsibility refers to the ethical and moral obligation of individuals and organizations to act in ways that benefit society as a whole, beyond their own interests. It encompasses the idea that individuals and organizations have a responsibility to consider the impact of their actions on the environment, society, and other stakeholders, and to act in ways that promote the greater good. Therefore, it is a crucial aspect of a business's long-term strategy.

To learn more about  Social responsibility :

https://brainly.com/question/14768187

#SPJ11

A basic tenet of Hinduism is the belief that Responses A the founder of Hinduism is Vishna.the founder of Hinduism is Vishna. B it is impossible to achieve moksha.it is impossible to achieve moksha. C everything in the world is an aspect of Brahman.everything in the world is an aspect of Brahman. D devas cannot be portrayed in art.

Answers

A basic tenet of Hinduism is the belief that responses everything in the world is an aspect of Brahman. Thus, option (c) is correct.

What is Hinduism?

Hinduism is a religion or karma in India, which is a religious and universal system or approach to life. Hindus believe in the necessity of appropriate behavior, which includes countless ceremonies, and the spiritual enlightenment objective of Hindus is emancipation.

As per the Hinduism beliefs, Brahman means the universe. It was the everything in the world  something that is eternal truth, genderless, infinite and bliss which does not modify. It was the reasoned to be a thought which bind all single integrity that are in our world.

As a result, the conclusion of the basic tenet of Hinduism is the belief are the aforementioned. Therefore, option (c) is correct.

Learn more about on Hinduism, here:

https://brainly.com/question/771499

#SPJ1

Explain how you can ensure that corruption does not form part of your e- business​

Answers

It takes a combination of preventative measures, monitoring, and corrective action to prevent corruption in e-business.

How to ensure corruption does not form part of your e- business.

Ensuring that corruption does not form part of your e-business requires a combination of preventative measures, monitoring, and corrective action. Here are some steps that can be taken:

Develop a Code of Conduct: Create a code of conduct that sets out ethical and legal standards for your e-business. Ensure that all employees, stakeholders, and partners are aware of the code of conduct and understand the implications of non-compliance.

Implement Strong Internal Controls: Implement strong internal controls to prevent corruption, such as anti-bribery policies, segregation of duties, and regular audits. Establish a system for reporting and investigating any suspicious behavior.

Conduct Due Diligence on Partners: Before entering into partnerships or contracts with third-party vendors, conduct due diligence to ensure that they have a strong track record of ethical behavior.

Learn more on corruption on e-business here: https://brainly.com/question/16697333

#SPJ1

Jeff Bezos decided to install productivity tracking
software at the Amazon offices to monitor the effort exerted by the
employees there Explain why this approach may not be effective in
inducing the employees to exert high effort"

Answers

Jeff Bezos decided to install productivity tracking software at the Amazon offices to monitor the effort exerted by the employees there. This approach may not be effective in inducing the employees to exert high effort as it may cause employees to become demotivated, feel monitored and resentful, and could lead to a feeling of being micromanaged.

Employees need to feel trusted and autonomous to be motivated to put in effort. Monitoring their effort could have the opposite effect.
Productivity tracking software may not be effective in inducing employees to exert high effort for several reasons. First, it can create a sense of mistrust between the employees and management, leading to lower morale and potentially lower productivity.

Additionally, the software may not accurately capture the effort exerted by employees, as there are many factors that can impact productivity that are not easily measurable, such as creativity and problem-solving skills. Finally, the use of productivity tracking software can lead to a focus on quantity over quality, resulting in employees cutting corners or sacrificing the quality of their work in order to meet productivity goals.

Overall, while productivity tracking software may seem like a good idea in theory, it may not be the most effective approach in practice.

To know more about productivity tracking refer here :

https://brainly.com/question/18881751#

#SPJ11

Which theory describes the motion of and force driving earth's plates. ?

Answers

Theory of tectonic plates describes the motion of and force driving earth's plates.

According to the idea of plate tectonics, Earth's crust is made up of enormous solid rock slabs called "plates" that move over the mantle, the rocky inner layer above the planet's core. The crust and uppermost mantle together make up the solid lithosphere, which is the outermost layer of the planet. Its thickness, according to the Encyclopedia Britannica, is 100 kilometres (60 miles) (opens in new tab). The asthenosphere, a viscous layer below the lithosphere, is kept flexible by heat deep beneath the Earth (opens in new tab). It facilitates movement of the lithosphere by lubricating the undersides of the tectonic plates of the Earth.

Learn more about tectonic plates here:

https://brainly.com/question/19317822

#SPJ4

There are 100 consumers in the economy. Among these consumers, 50 of them have an income of 10 each and the rest have an income of 20 each. Let y denote a consumerís income. For each consumer, the indirect utility function is given byv (p; y) = 5 ln y 2 ln p:i. Solve for the Marshallian demand function for an individual consumer.ii. Calculate the equilibrium market price: p (n).iii. There is an entry fee to this competitive market, . Due to the pandemic, a third of the Örms have dropped out of the industry. Solve for the number of Örms currently remain operating.

Answers

i) The Marshallian demand function for an individual consumer can be obtained by solving for the optimal consumption bundle that maximizes the utility function subject to the budget constraint.

ii.) The equilibrium market price can be obtained by setting the market demand equal to the market supply and solving for the price.

iii) It will obtained by subtracting the number of firms that have dropped out from the total number of firms.

This is done by setting the marginal utility of consumption equal to the marginal utility of income and solving for the optimal quantity of the good. The marginal utility of consumption is given by the derivative of the utility function with respect to the quantity of the good, while the marginal utility of income is given by the derivative of the utility function with respect to income. Thus, the Marshallian demand function is given by: x = (y/2p)

The market demand is given by the sum of the individual demand functions, while the market supply is given by the sum of the individual supply functions. Thus, the equilibrium market price is given by:p = (100y/100x)

iii. The number of firms currently remaining in the market can be obtained by subtracting the number of firms that have dropped out from the total number of firms. Since a third of the firms have dropped out, the number of firms currently remaining is given by:n = (2/3)Nwhere N is the total number of firms.

For such more question on equilibrium:

https://brainly.com/question/29618306

#SPJ11

Jack lives in a fictional country of Abrams, which raises government revenue by taxing everyone the same amount. The government of Abrams has just implemented a tax cut that reduces annual taxes by $2,000 per person. However, government spending has not changed, nor will it likely in the future. the tax cut has raised Jack's income by $2,000.
If jack acted according to the prediction of new classical economics (and doesn't plan to leave Abrams) , his consumption is likely to increase by ($0, $1,800,$2,000).
Suppose that instead of cutting taxes while keeping its spending the same, the government did the opposite:
increased its spending by $2,000 per person while keeping its taxes the same. If everyone in Abrams acted like Jack, the likely increase in aggregate demand ($0, $1,800, $2,000) per person.

Answers

According to the prediction of new classical economics, Jack's consumption is likely to increase by $0 after the tax cut.

This is because new classical economics assumes that individuals are rational and forward-looking, and will therefore save the extra $2,000 in anticipation of future tax increases to pay for the unchanged government spending.

Similarly, if the government instead increased its spending by $2,000 per person while keeping its taxes the same, the likely increase in aggregate demand per person would also be $0. This is because individuals, like Jack, would anticipate future tax increases to pay for the increased government spending and would therefore save the extra income rather than increase their consumption.

Therefore, the correct answers are:
- Jack's consumption is likely to increase by $0 after the tax cut.
- The likely increase in aggregate demand per person after the government increases its spending is $0.

Learn more about classical economics https://brainly.com/question/2965799

#SPJ11

What should government do with its spending and taxes during an
upturn in the business cycle? Why?

Answers

During an upturn in the business cycle, the government should reduce its spending and increase taxes.

What Should Government Do During An Upturn In The Business Cycle?

The type of policy that government should do during an upturn in the business cyle is contractionary fiscal policy, and it is designed to help prevent the economy from overheating and causing inflation. By reducing spending, the government can decrease the amount of money circulating in the economy, which can help to reduce demand and keep prices stable. Additionally, by increasing taxes, the government can reduce the amount of disposable income that people have, which can also help to reduce demand and keep prices stable. Overall, the goal of contractionary fiscal policy during an upturn in the business cycle is to help keep the economy stable and prevent inflation.

Learn more about contractionary fiscal policy at https://brainly.com/question/9504329

#SPJ11

100 POINTS!!!1 What are the 10 countries with the largest population?

Answers

Answer:

China - 1,397,715,000

India - 1,366,417,750

United States - 328,239,520

Indonesia - 270,625,570

Pakistan - 216,565,320

Brazil - 211,049,530

Nigeria - 200,963,600

Bangladesh - 163,046,160

Russian Federation - 144,373,540

Mexico - 127,575,530

Explanation:

Explanation:

1. China: 1.4 billion

2. India: 1.35 billion

3. United States: 329 million

4. Indonesia: 270 million

5. Brazil: 211 million

6. Pakistan: 207 million

7. Nigeria: 198 million

8. Bangladesh: 166 million

9. Russia: 144 million

10. Mexico: 127 million

Suppose that a country has a production function, where L is labour, K is capital and A is total factor productivity, as follows:
Y = F(K, L) = A×K0.25L0.75
Write the production function in "intensive form" (output per worker as a function of capital per worker). (10%)
Suppose, initially, that A = 4 and its growth rate is zero. The country has a population growth of 1% per year (0.01) and a depreciation rate of 10% (0.10). If the country saves 30% of national income, find the steady state levels of capital per worker, as well as consumption and income per worker. (50%)
What would be the rate of growth of output and output per capita in steady state? (10%)
If the savings rate decreases to 10%, will income per capita increase or decrease in steady state? And the rate of growth of income per capita? Explain your answer, but you do not need a numerical solution. (30%)

Answers

The steady-state levels of consumption and income per worker are 6.098 and 8.711, respectively.

The production function in intensive form can be written as:
y = f(k) = A×k^0.25
where y is output per worker and k is capital per worker.

To find the steady-state levels of capital per worker, we can use the equation:
s×f(k) = (δ+n)×k
where s is the savings rate, δ is the depreciation rate, and n is the population growth rate.
0.30×4×k^0.25 = (0.10+0.01)×k
1.2×k^0.25 = 0.11×k
k^0.75 = 10.909
k = 27.080

The steady-state level of capital per worker is 27.080. To find the steady-state levels of consumption and income per worker, we can use the equations:
y = f(k) = A×k^0.25
c = (1-s)×y

y = 4×27.080^0.25 = 8.711
c = (1-0.30)×8.711 = 6.098

The steady-state levels of consumption and income per worker are 6.098 and 8.711, respectively.

In a steady state, the rate of growth of output and output per capita is zero, as there is no change in the levels of capital per worker, labor, and total factor productivity.

If the savings rate decreases to 10%, the steady-state levels of capital per worker, consumption, and income per worker will decrease. This is because a lower savings rate means less investment in capital, leading to lower levels of capital per worker and lower levels of output per worker. The rate of growth of income per capita will also decrease, as there is less investment in capital and lower levels of output per worker.

To know more about the production function click here:

https://brainly.com/question/13646635

#SPJ11

1. Supreme
2. Capital
3. Juveniles
4. Felonies
5. Death​

Answers

In order ( No explanation needed)

1.) Capital

2.) Death

3.) Supreme
(Capitol)-(death)-(supreme)

The government's deficit is $20B. It gets the money to pay for this deficit by Select one: a. Demanding Bonds b. Supplying Bonds c. Reducing Taxes d. Increasing Spending

Answers

Answer:

B - Supply Bonds

Explanation:

Supplying bonds means issuing bonds. It is also known as borrowing money.

The government then sells the bonds to investors to make up for the deficit.

The investors that bought the bonds will receive interest payments periodically until the whole bond is paid off by the government.

The government's deficit is $20 billion, a deficit occurs when the government spends more money than it collects in taxes. The correct answer is b. Supplying Bonds.

Bonds, which are essentially a form of loan from investors who purchase the bonds, may be provided by the government as a means of financing the deficit. This may be done by the government.

The government has guaranteed that the loan would be repaid, together with interest, at a later period.

When the government issues bonds, it is able to collect the necessary funds to pay for the deficit without having to immediately raise taxes or reduce spending. This frees the government from having to choose between the two options.

The current deficit of the government is estimated to be $20 billion, and it is being financed by the issuance of bonds.

Therefore, the correct answer is b. Supplying Bonds.

Learn more about Supplying Bonds.

https://brainly.com/question/30000022

#SPJ11

If the price of 3G data bundles, a substitute for fixed-line data bundles, decreases, then:
Select one:
a. The quantity of fixed-line data bundles demanded will increase.
b. The supply curve of fixed-line data bundles will shift to the right.
c. The demand curve for fixed-line data bundles will shift to the right.
d. The demand curve for fixed-line data bundles will shift to the left.
e. The equilibrium quantity and price of fixed-line data bundles will not change.

Answers

If the price of 3G data bundles, a substitute for fixed-line data bundles, decreases, then the demand curve for fixed-line data bundles will shift to the left. The correct answer is d. This is because consumers will now switch from fixed-line data bundles to 3G data bundles as the price for 3G data bundles has gone down.

As a result, the quantity of fixed-line data bundles demanded will decrease, and the supply curve for fixed-line data bundles will shift to the right. As a result of the decrease in demand and increase in supply, the equilibrium quantity and price of fixed-line data bundles will change.


The demand curve for fixed-line data bundles will shift to the left. When the price of a substitute good decreases, the demand for the original good decreases as well.

In this case, if the price of 3G data bundles decreases, then people will be more likely to purchase 3G data bundles instead of fixed-line data bundles. This will lead to a decrease in the demand for fixed-line data bundles, causing the demand curve to shift to the left.

As the demand curve shifts to the left, the equilibrium quantity and price of fixed-line data bundles will also decrease. This is because the decrease in demand will lead to a surplus of fixed-line data bundles, causing suppliers to lower the price in order to sell more units.

To know more about price refer here :

https://brainly.com/question/15228989#

#SPJ11

Other Questions
Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose? PLEASEEEE HELP ASPPPPP Cambodia rice export to EU countries within EBA (research purpose) 4: 7 and 12 : whats the ratio To organize this text, the author divides it into sections with subheadings. What is described in the section with the subheading "Darwin Is Stumped"? I How does the author's use of the word "assaulted* in paragraph 2 contribute to ourunderstanding of Hitler's propaganda?A.It shows that German citizens would not readily believe propaganda.B.It reveals that German citizens were physically attacked with propaganda.C.It emphasizes that the German government's propaganda campaign wasforceful.D.It shows readers that German citizens didn't like the propaganda they wereexposed to. What is the area of this polygon?16 cm224 cm240 cm218 cm2 Given that 224 hours of work need to be done to complete a project. (1) How long will it take 4 men, each working an 8-hour day to complete the project? (II) If each of them is paid 57-50 per hour, how much will it cost to employ them altogether? (iii) How many hours of overtime must they put in per day if the project is to be completed in 4 days? (iv) Given that the overtime rate of payment is l times as much as the regular hourly rate, find the cost of the project now. 8. DEF is an equilateral triangle.The midsegments of ADEF form AAB.What type of triangle is AABC? Explain your reasoning. Table 1: Time Required for Methylene Blue Color Change (10 points)Milk Sample Start Time/Date (Step 10) End Time/Date (Step 11) Time Elapsed (End Time- Start Time)0 hours 1 hour 3 hours 4 hours A rectangle has a length of 6 centimeters and a width of x + 10 centimeters. Write an expression to represent the rectangles: area (square centimeters Alex has a pile of two pence coins. She swapped exactly half of them for the same number of 10p coins. Now she has 4.20. How much money did Alex have initially?" For the given word problem, write a system of equations, clearly define any variables, and show work for full credit.A photographer is mixing 5% acetic acid solution with a 10% acetic acid solution to get two liters of a 7% solution.How many liters of each solution should he add? What is the velocity of a 1,000.0 kg car if its kinetic energy is 200 kJ?