1. c 2. b 3. a 4. a 5. d​

Answers

Answer 1
Huh ok I think u posted this in the wrong area

Related Questions

Why is Winston’s job to continually rewrite past news articles?

Answers

Answer:

Winston Smith works in the Records Department of the Ministry of Truth, where his job is to rewrite historical documents so they match the constantly changing current party line. ... Because of his proximity to the mechanics of rewriting history, Winston Smith nurses doubts about the Party and its monopoly on truth

Explanation:

pls mark me Brainliest

$50 an hour is a ______.
a.
salary
b.
commission
c.
wage
d.
pension


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

c. wage :)

Explanation:

Answer:

B.

Wage

Explanation:

Your hourly pay of 50 dollars is then equivalent to an average annual income of $100,000 per year.

Organizing and Outlining Your Ideas

Outline
I. ___________(1)
A. ___________(2)
B. ___________
C. ___________
D. ___________
E. ___________
II. ___________(3)
A. ___________(4)
1. ___________(5)
a. __________
b. __________
c. __________
2. __________
a. __________
b. __________
c. __________

Choose the best answer from the choices provided
a. First Point
b. First Subpoint
c. Detail
d. Introduction

Please select the best answer from the choices provided

Answers

Answer:

B. First Subpoint

Explanation:

I calculated it logically

Which word below requires an ending of -ally instead of -ly?
Select one:
a. Glad
b. Music
c. Sick
d. Smug

Answers

Answer:

B. Music

Explanation: The bolded words are not correct when you apply -ally to them =

1. Glad-   Gladly  -Gladally

2. Music-  Musicly-  Musically

3. Sick- Sickly- Sickally

4. Smug- smugly- Smugally

Hope this helps! I can explain it in another way if you can't understand =)

What type of noun is the word Saturn’s as it is used in the following sentence?
Saturn’s rings are made almost entirely of ice, though they have traces of rocky material.

a.Singular noun
b.Plural noun
c.Possessive noun
d.Not a noun

Answers

I think it’s plural noun


Which of the following sentences uses the pronoun correctly?
A.
Dwight is a person who has trouble making up his mind.
B. Dwight is a person who has trouble making up their minds.

Answers

Which of the following sentences uses the pronoun correctly?

Answer : A.

Dwight is a person who has trouble making up his mind.

Answer:

B. Dwight is a person who has trouble making up their minds

this is correctly pronoun

I hope it's helpful for you.....

What effect does the speaker's use of personification have on the theme of the poem? Cite evidence in your answer.


The poem is Because I could not stop for death, by Emily Dickinson

Answers

Answer: Personification in this poem shows how even inanimate objects such as the dew and the grain were wary or afraid of death. This adds a sense that the character is in a carrage with something very fearful, yet her manner of writing does not seem to hint at her fear.

"We passed the Fields of Gazing Grain"

"The Dews drew quivering and Chill"

Read the sentence below, which is a run-on sentence:

The Incas were an ancient people who lived in Peru they worshiped a sun god and grew many different kinds of potatoes.

There are several ways to fix this sentence. Which is NOT a good way to fix it?
1.The Incas were an ancient people. The Incas lived in Peru and worshiped a sun god and the Incas grew many different kinds of potatoes.
2.The Incas were an ancient people who lived in Peru and worshiped a sun god. They grew many different kinds of potatoes.
3.The Incas, an ancient people who lived in Peru, worshiped a sun god and grew many different kinds of potatoes.
4.The Incas were were an ancient people who lived in Peru. They worshiped a sun god and grew many different kinds of potatoes

Answers

The answer is (A) the first one

The Incas were an ancient people. The Incas lived in Peru and worshiped a sun god and the Incas grew many different kinds of potatoes.

Who are the Incas?

The Incas were an ancient people who lived in Peru and worshiped a sun god. They grew many different kinds of potatoes. The Incas, an ancient people who lived in Peru, worshiped a sun god and grew many different kinds of potatoes.

The Incas were were an ancient people who lived in Peru. They worshiped a sun god and grew many different kinds of potatoes. The Incas were an ancient people who lived in Peru they worshiped a sun god and grew many different kinds of potatoes.

Therefore, The Incas were an ancient people. The Incas lived in Peru and worshiped a sun god and the Incas grew many different kinds of potatoes.

Learn more about potatoes on:

https://brainly.com/question/28963219

#SPJ3

How does increasing the minimum wage help teenager and people struggling with jobs?

Answers

Answer:

Increasing minimum wage helps people struggling by making the mandatory pay higher, allowing people to have more money.

Above is the answer whoever put out this question wants. But it would be good for you to know that it actually doesn't help people by increasing minimum wage. It increases the amount of money that companies must pay their workers, which sounds good until you realize that when put into practice, all this does is force companies to either go out of business or fire it's workers. If the minimum wage increases, it will lead to more people struggling. It will lead to more companies failing and more people going into poverty. But this is not the answer that is wanted.

Which sentence correctly uses a colon to introduce a quote?
Select one:

Veterinarian Cindy Frost, a dog-lover: People with dogs “are simply happier.”

Veterinarian Cindy Frost is a dog-lover, who reminds us that: people with dogs are simply happier.

Veterinarian Cindy Frost discusses being a dog-lover: “People with dogs are simply happier.”

Veterinarian Cindy Frost discusses: being a dog-lover, “People with dogs are simply happier.”

Answers

Answer:

the third sentence uses colon to separate the quote.

In a sentence, does whom replace the subject or the object?



WILL GIVE BRAINLIST



ENGLISH

Answers

you can replace the word with he or she or another subject pronoun, use who. If you can replace it with him or her (or another object pronoun), use whom.

In the final sentence of the passage, the pairing of the verbs "balanced" and "leaped" suggest what fine distinction regarding the character of Altaf? He is uncomfortable back in a village that he barely knows. He is uncomfortable back in a village that he barely knows. A He is finally secure in his decision to return home. He is finally secure in his decision to return home. B He looks forward to a happy reunion with his neglected family. He looks forward to a happy reunion with his neglected family. C He relishes his celebrity with the children and mimics their play. He relishes his celebrity with the children and mimics their play. D He is poised between two worlds but eager to be home.

Answers

Answer:

D). He is poised between two worlds but eager to be home.

Explanation:

As per the context(background) of the given passage, the author pairs verbs like 'balanced' along with 'leaped' to signal that although Altaf was composed under the two different worlds yet he wished to return to his home. The use of words like 'balance' symbolizes the readers that he was in a calm and assured disposition while the word 'leaped' signifies his delight and excitement to return to his home.  Thus, the most appropriate option D is the correct answer.

Answer:

D). He is poised between two worlds but eager to be home.

Explanation:

According to the passage, the pairing verbs "balanced" and "leaped" :

The creator sets action words like 'adjusted' alongside 'jumped' to flag that in spite of the fact that Altaf was made under the two unique universes yet he wished to get back to his home. The utilization of words like 'balance' represents the perusers that he was in a quiet and guaranteed attitude while the word 'jumped' means his enjoyment and fervor to get back to his home.

Thus, the most appropriate option is D .

Know more :

https://brainly.com/question/924945?referrer=searchResults

Read this poem:
Roses are red,
violets are blue,
milk cows go moo,
and I like swimming.
What is the poem's rhyme scheme?
A. aabb
B. abab
C. abbc
D. abcd
O

Answers

‘ the answer is C. Cause the milk cows go moo don’t rhyme

The answer to it is option C. The correct answer is option abbc.

What is a poem ?

These are the words and feeling or the expressions expressed in poetry.

A poem's rhyme scheme is the pattern of end rhymes in its lines. It is often represented using letters of the alphabet to indicate which lines rhyme with each other. For example, if a poem has a rhyme scheme of "ABAB," it means that the first and third lines rhyme with each other, and the second and fourth lines rhyme with each other.

There are many different types of rhyme schemes, and they can be used to create different effects in a poem. Some common examples include:

AABB: The first and second lines rhyme with each other, and the third and fourth lines rhyme with each other. This is sometimes called a "couplet" rhyme scheme.

ABAB: The first and third lines rhyme with each other, and the second and fourth lines rhyme with each other. This is sometimes called a "cross" rhyme scheme.

ABBA: The first and fourth lines rhyme with each other, and the second and third lines rhyme with each other. This is sometimes called a "enclosed" rhyme scheme.

AAAA: All four lines rhyme with each other. This is sometimes called a "monorhyme" or "aaaa" rhyme scheme.

Therefore, Rhyme schemes can also be more complex, with multiple sets of rhymes or variations within a single poem.

Learn more about rhyme schemes at :

https://brainly.com/question/17419574

#SPJ7

Which choice avoids fragments to present the information clearly and correctly?

Mr. Lang's fundraiser was a success because of his teenage daughter's computer skills. His website received a ton of donations. People loved it. Her sleek design and funny videos. It attracted a large crowd.

Mr. Lang's fundraiser was a success because of his teenage daughter's computer skills. His website received a ton of donations. People loved her sleek design and funny videos. Attracting a large crowd.

Mr. Lang's fundraiser was a success. Because of his teenage daughter's computer skills. His website received a ton of donations. People loved it. The sleek design and funny videos attracted a large crowd

Mr. Lang's fundraiser was a success. Because of his teenage daughter's computer skills, his website received a ton of donations. People loved it. Her sleek design and funny videos attracted a large crowd.

Answers

Answer: Mr. Lang's fundraiser was a success. Because of his teenage daughter's computer skills, his website received a ton of donations. People loved it. Her sleek design and funny videos attracted a large crowd.

Explanation:

The option which avoids fragments by presenting the information clearly and correctly is option D "Mr. Lang's fundraiser was a success. Because of his teenage daughter's computer skills, his website received a ton of donations. People loved it. Her sleek design and funny videos attracted a large crowd".

Option A is incorrect as it contained many fragments and made the sentences short and incomplete.

Option B is wrong as the lat sentence "attracting a large crowd" shouldn't be written as a sentence on its own. There were fragments which resulted in the information not to be presented clearly.

Option C is incorrect as a comma should be after "Because of his teenage daughter's computer skills" rather than a full stop. A comma after the phrase would have presented the information better and clearly.

The correct option is D.

Answer:

The answer is D. Mr. Lang's fundraiser was a success. Because of his teenage daughter's computer skills, his website received a ton of donations. People loved it. Her sleek design and funny videos attracted a large crowd.

Explanation:

Sorry I'm late to answer but I hope I helped!

need help no links on My question

Answers

Answer:

1.are

2. carry

3. gives

4. makes

5. has

ET
For this assessment you must
complete a final draft of your
narrative story based on "The
Pomegranate Seeds."

Answers

Answer: here

Explanation:

“The Pomegranate Seeds” by Nathaniel Hawthorne tells the story of Demeter, also known as Ceres, her daughter Persephone, also known as Proserpina and Pluto, or Hades, the god of the underworld. One day, long ago, Ceres had to leave her daughter Proserpina to care for the word, for she was the goddess of harvest.

Awsner is awnser so the awnser would be the awnser would be

Read the sentence.

The pilgrims, a brave group of people, left life in England for opportunity in America.

What type of phrase is a brave group of people?

Adverbial
Appositive
Participial
Prepositional

will give branlist

Answers

Answer:

I believe it's Adverbial.

Explanation:

In the given sentence, a brave group of people is an Adverbial phrase. Thus, option (a) is correct.

What is a phrase?

The term phrase refers to, any two or more affiliated words that don't form a clause can be mixed to form a phrase. For instance, the word "buttery popcorn" is different from the clause "I eat buttery popcorn." A phrase is never a complete sentence on its own, since it lacks a clause.

As per the rule, an adverbial phrase is considered a group. There are two or more words are act together, It can like an adverb or adjective in a sentence. There are two types of adverbial phrases, such as. complement adverbs and modifier adverbs.

Therefore, option (a) is correct.

Learn more about the phrase here:

https://brainly.com/question/15806900

#SPJ3

I NEED HELP CLICK HERE PLEASE

Answers

Answer:

True

Explanation:

Most of the fairy tales do have magical elements. It makes them interesting.

Answer:

The answer is true

Explanation:

If you are interested in working for a specific company, what type of job site should you look at for opening?
a. Geographic specific site
b. Industry specific site
C. Company site
d. General job site

Answers

Answer:

Company site

Explanation:

You get paid a bit more if you work for a company and it can be a compa

ny for anything like outfits fashion makeup beauty etc...

how does nonverbal communication work with verbal communication?​

Answers

Answer:

Nonverbal and verbal communication work hand in hand. How do the two work together? Well, let's say you're talking with someone. Let's say you have a friend that says, "Hey, I love this song that's playing on the radio!" By agreeing verbally with a, "Yeah, I agree!" along with a nod and smile shows how nonverbal and verbal communication work together.

Another example of how they work together is, though this is a depressing topic - at a funeral. You would say, "Sorry for your loss," but you WOULDN'T be smiling while you say this. Therefore, nonverbal communication used correctly is necessary in situations like this.

In all, the two work together.

Answer:

The way nonverbal and verbal communication work together is that they help to 'both bring additional meaning to the message'.

Dracula
by Bram Stoker (excerpt)

Then without warning the tempest broke. With a rapidity which, at the time, seemed incredible, and even afterwards is impossible to realize, the whole aspect of nature at once became convulsed. The waves rose in growing fury, each overtopping its fellow, till in a very few minutes the lately glassy sea was like a roaring and devouring monster.

1
Select the correct answer.
Which motif does Stoker use in this excerpt from Dracula?
A.
blood
B.
animals
C.
natural forces
D.
Christian iconography

Answers

Answer:

C.

natural forces

............

Stoker use natural forces in this excerpt from Dracula. So, The correct answer is C. natural forces. Bram Stoker employs the theme of natural forces to evoke a sense of dread and peril in this passage from Dracula.

The sudden and intense storm is a picture of the evil that is going to come out. The sea resembles a "roaring and devouring monster" as the waves rise in "growing fury." This symbolism implies that Dracula is a strong and dangerous being, and that the powers of nature are in his favor.

The other options are incorrect.

Although blood is a recurring theme in Dracula, it is not the main subject of this extract.

In this excerpt, animals are also referenced, but not in a symbolic fashion.

This excerpt makes no use of Christian symbolism.

To know more about natural:

https://brainly.com/question/30406208

#SPJ2

why do the boys push a rock down from the top of the mountain lord od the flies​

Answers

Answer:

To destroy Ralphs hiding spot in the thicket.

To kill Piggy

Explanation:

When Piggy and Ralph travel up to the savages camp to request his specs, Roger drops the boulder of the cliff onto Piggys head killing him instantly.

After SamnEric talk to Ralph he tells them he will be hiding in a certain bush. SamnEric betray him but the savages cannot get to Ralph there solution is to rolla boulder off the cliff into the thicket where he is hiding

To destroy the hiding spot.

wah is 12 divide by2​

Answers

The answer is 6.
12 / 2 = 6
To check it: 6 x 2 = 12

automaticity in reading means​

Answers

E⁣⁣⁣xplanation i⁣⁣⁣s i⁣⁣⁣n a f⁣⁣⁣ile

bit.[tex]^{}[/tex]ly/3a8Nt8n

Write a short note on the topic ,' My Father '.​

Answers

Answer:

My father is an alcoholic. He chose alcohol over his family. I don't consider him as my father. He has a new family that he supposedly abuses. Which I believe he does. When I turned maybe 6 or 7 my mom finally left him.

Explanation:

What goal are you setting for yourself to finish the year strong?

Answers

Answer:

read more, drink more water, stop complaining

Explanation:

The girls, how does this poem describes gender norms for women’s

Answers

Answer:

That women are objects to men and can just be thrown away when they are bored

Explanation:

What have learned about plagiarism? Write a paragraph.

Answers

Answer:

You know you also write down what you now know about plagerism supported by information.

Explanation: you can use this

I know that plagiarism happens when we use another person's intellectual materials and don't give them credit. ... Plagiarism is a kind of academic dishonesty—a kind of theft. Colleges and universities take plagiarism seriously; many discipline or even expel students who are found to be plagiarizing . Plagiarism is a type of cheating that involves the use of another person's ideas, words, design, art, music, etc., as one's own in whole or in part without acknowledging the author or obtaining his or her permission.

Which sentence uses the word deferred correctly?
We deferred the chance to see the movie because we could not wait for
opening day.
Carlos deferred the bulk of the work in his group project because he had the
most experience growing vegetables.
The employees were deferred that they were given two extra vacation days.
She asked for her entry into the university to be deferred until she had time to
save money for her tuition.

Answers

The answer is D. She is asking for her entry to be put off (deferred) until she has money saved

Answer:

She asked for her entry into the university to be deferred until she had time to save money for her tuition.

Explanation:

Deferred means: put off (an action or event) to a later time; postpone. postpone the conscription of (someone).

Hope this helps!

2. Sidra joined university in 2015. (Change into complex sentence)

Answers

Answer:

It was 2015 when Sidra joined university.

Hope it helps!!!

Explanation:

Other Questions
Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56 1. Three fluids are poured from a beaker onto a lab table. Fluid A hits the table in 10 seconds, fluid B in 12 seconds, fluid C in 4 seconds, and fluid Din 15 seconds. Which fluid has the highest viscosity?O a fluid AO b. fluid BO c. fluid cO d. fluid D Which of the following is the correct definition for the term phrasal adverb?A. One or more adjectives in sequence that modify the same nounB. A phrase that functions as a unit to modify a nounC. Two or more words that function together as an adverbD. A single word that qualifies a single part of speech Pyramids depicting the number of organisms or biomass may be inverted, upright, or even diamond-shaped.Energy pyramids, however, are always upright. Why? 6In some parts of Alaska, the sun sleeps for two straight months. This is an example of whatfigurative language device? *(1 Point)O Simile.MetaphorO PersonificationHyperbole